Table 3. PCR primers used in the present study to amplify targeted gene regions.

	Name	Sequence (5′ ––3′)	Gene	Product size	Cycle	Reference
1	CO3Bam5657f	gctgctagttggtattggcat	cox3	1–15: 1014 bp	94:20,55:30,72:50	[58]
2	ND4L2475F	tagttttactggcctctac	nad4L			[58]
3	ND42625F	tacgtggyacaattgctg	nad4L	3–10: 476 bp	94:20,50:30,72:30	[58]
4	MSH2714F	cttaatggaggagaattattc	mtMutS			this publication
5	MSH2806F	taactcagcttgagagtatgc	mtMutS			[58]
6	msh2864r	gaggcaacttgttcaatgggaggtg	mtMutS			this publication
7	MSH3010F	ggataaaggttggactattatag	mtMutS	7–16: 448 bp	94:20,55:30,72:30	[6]
8	MSHLA3034R	cctgagatactgcgcgttgtttaggccccg	mtMutS			[58]
9	MSH3055R	ggagaataaacctgagayac	mtMutS			[58]
10	MSH3101R	gatatcacataagataattccg	mtMutS			[59]
11	MSH3186F	gccatgartgggcatagtata	mtMutS			this publication
12	msh3208r	atcgagcyactttgtccckgtc	mtMutS			this publication
13	MSH3332F	cttattaattggttggaa	mtMutS			this publication
14	MSH3350F	gccatgartgggcatagtata	mtMutS			this publication
15	MUT3458R	tsgagcaaaagccactcc	mtMutS	2–15: 940 bp	94:20,50:30,72:50	[59]
16	MUTChry3458R	tgaagyaaaagccactcc	mtMutS	2–16: 940 bp	94:20,50:30,72:50	this publication
17	MSH3841F	ctgcgttatgaggagattgckac	mtMutS			this publication
18	MSH4094F	cagtcggacctcaattagaatcg	mtMutS			this publication
19	MSH4332R	gaaggcataaccctccttactg	mtMutS	14–19: 920 bp	94:20,50:30,72:50	this publication
20	MSH4757R	gacttgcccgcaccatttactg	mtMutS			this publication
21	MSH4759F	tgtagctcatgatattag	mtMutS			[41]
22	MSH4915R	cgacctcaaaagtaccttgacc	mtMutS	18–22: 830 bp	94:20,50:30,72:50	this publication
23	MSH5065F	gcaacaattgaaagattraca	mtMutS			this publication
24	MSH5075R	gagtagamagarcgaaactag	mtMutS			this publication
25	MSH5376R	agctccacatatttcacac	mtMutS			this publication
26	16S5PR	tcacgtccttaccgatag	16S	21–26: 900 bp		[41]
27	COII8068xF	ccataacaggrctwgcagcatc	cox2			[15]
28	COIoctR	atcatagcatagaccatacc	cox1	27–28: 1080 bp	94:20,50:30,72:60	[54]
29	18S-Af	aacctggttgatcctgccagt	18S			mod. [76]
30	18S-Lr	ccaactacgagctttttaactg	18S	29–30: 620 bp	94:20,60:30,72:40	[77]
31	18S-Cf	cggtaattccagctccaatag	18S			[77]
32	18S-Yr	cagacaaatcgctccaccaac	18S	31–32: 710 bp	94:20,60:30,72:40	[77]
33	18S-Of	aagggcaccaccaggagtggag	18S			[77]
34	18S-Br	tgatccttccgcaggttcacct	18S	33–34: 620 bp	94:20,60:30,72:40	mod. [76]

Predicted fragment sizes (approximate, in bp) and PCR cycle profiles (temperature in °C: time in seconds) are given for the most commonly used primer pairs. Primer combinations are listed in the product size column, prior to the predicted fragment size, using the primer numbers defined in the first column. (mod.: modified from). Between 30 and 45 cycles were used for PCR.