Table 1.

Effects of phosphate neutralization on EcoRV-DNA equilibrium binding

Enzyme	DNAa	KA (M−1)b	KA(ref)/KAd	ΔΔG°bind (kcal/mol)d
wild type EcoRV	GATATC	1.0 (±0.1) ×1011	1	0
CONCAVE FACE
K119A	GATATC	1.5 (±0.1) ×107	6,500	+5.2 (±0.1)
K119A	Rp-PMe-2	7.7 (±1.4) ×108	133	+2.9 (±0.2)
K119A	PMe-2	2.1 (±0.1) ×108	476	+3.7 (±0.1)
R226A	GATATC	7.9 (±0.3) ×106	13,000	+5.5 (±0.1)
R226A	PMe-5	3.6 (±0.5) ×107	2,800	+4.6 (±0.4)
R221A	GATATC	5.7 (±0.5) ×	180	+3.1 (±0.1)
R221A	PMe-2	6.1 (±3.0) ×106	16,393	+5.7 (±0.4)
R221A	Sp-PMe-2	2.2 (±0.2) ×106	45,454	+6.3 (±0.1)
R221A	PMe-3	3.7 (±0.2) ×108	270	+3.3 (±0.1)
R221A	PMe-5	1.2 (±0.2) ×109	80	+2.6 (±0.1)
CONVEX FACE
R140A	GATATC	9.3 (±2.0) ×107	1100	+4.2 (±0.2)
R140A	PMe+3	8.2 (±0.2) ×106	12,200	+5.5 (±0.4)

^aThe double stranded 24 bp oligodeoxyribonucleotide d(TGTGTTGTAGGATATCCTACAGGT) was used for all equilibrium binding experiments. P_{Me (n)} denotes the position of P_Me substitutions (Fig. 2a), which were made symmetrically in both DNA strands. Unless diastereomer is specified, substitution was racemic R_P,S_P,-P_Me.

^bEquilibrium binding constants were measured at 295K in binding buffer plus 0.24 M K⁺

^cK_A(ref) is the equilibrium association constant for the unmodified DNA.

^dFor modified complexes with equilibrium association constant K_A,mod, the difference in standard binding free energy (ΔΔG°_bind) relative to that for a wild type EcoRV complex with unmodified DNA is calculated as ΔΔG°_bind = −RTln (K_A,_mod/K_A,unmod).