Table 3. Multiple sequence alignment of F1/F2 primers and FPPRrev target sites from different PPRV isolates of lineage II compared with isolates of lineage IV*.
| PPRV isolate† | F1 (primer 5′), nt 777–801 | F2 (primer 3′), nt 1124–1148 | FPPRrev (primer 3′), nt 2055–2079 |
|---|---|---|---|
| NIGERIA 75_1‡ | ATCACAGTGTTAAAGCCTGTAGAGG | GCTTGTAGGTCACAAACTCAGTCTC | TCCCTAGGGCTTGTCACATTAATAT |
| NIGERIA 76_1 | ------------------------- | ---G--------------------- | ------------------------- |
| ICV 89 | ------------------------- | ------------------------- | ------------------------- |
| SUNGRI 96 | ------------------------- | ---G-----------G---G-C--- | ------------------------- |
| China/TibetGeg07-30 | --------------A---------- | ---G-----C-----G---G-C--- | ------------------------- |
| TURKEY 00 | ------------------------- | ---G-----------G---G-C--- | ------------------------- |
*FPPRrev, new reverse primer designed in this study; PPRV, peste des petits ruminants virus. Nucleotide position (numbered according to GenBank accession no. X74443 sequence). The consensus sequence corresponds to the F gene of the PPRV Nigeria 75_1 vaccine strain. F1/F2 primers from (8). †Lineage and GenBank accession nos.: NIGERIA 75_1, lineage II, X74443; NIGERIA 76_1, lineage II, EU267274; ICV 89, lineage I, EU267273; SUNGRI 96, lineage IV, AY560591, China/TibetGeg07-30, lineage IV, FJ905304; TURKEY 00, lineage IV, AJ849636. ‡Vaccine strain.