Skip to main content
. 2012 Apr;93(2):115–124. doi: 10.1111/j.1365-2613.2011.00797.x

Table 1.

Primer sequences of the target genes

Gene symbol Forward primer Reverse primer Base pairs
MCP-1 atctgtgctgaccccaataagg gtggttgtggaaaagagagtgg 196
Tub1a aaccatgcgtgagtgtatctcc aactgtgggttccaggtctacg 226
HPRT aaaggacctctcgaagtgttgg ctttactggccacatcaacagg 213
LDHb gtcatcaaccagaagctgaagg agggaagaagcaaactgtgacc 194

Forward and reverse primers (5′–3′ orientation) for the specific genes have a product length of the corresponding base pairs.