Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences for RT-PCR assay
| Target | Sequence | Products (bp) | |
|---|---|---|---|
| SSTR 1 | forward | tgagtcagctgtcggtcatc | 93 |
| reverse | ggaaagagcgcttgaagttg | ||
| SSTR 2 | forward | ctttgtggtggtcctcacct | 100 |
| reverse | gcagaggacattctggaagc | ||
| SSTR 3 | forward | ttcctctcctaccgcttcaa | 123 |
| reverse | ctcctcctcatcctcctcct | ||
| SSTR 4 | forward | tctttgtgctctgctggatg | 96 |
| reverse | ggataagggacacgtggttg | ||
| SSTR 5 | forward | cccttcttcaccgtcaacat | 102 |
| reverse | gttggcgtaggagaggatga | ||
| GAPDH | forward | ggaaggtgaaggtcggagtca | 101 |
| reverse | gtcattgatggcaacaatatccact |
