Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers for Sox2, Oct4 and β-actin genes.
| Gene name | Primer sequence | Size (bp) | Annealing temperature (°C) |
|---|---|---|---|
| Sox2 | F cccccggcggcaatagca R tcggcgccggggagatacat |
448 | 58 |
| Oct4 | F tcccttcgca agccctcat R tgacggtgcagggctccggggaggccc catc |
408 | 55 |
| β-actin | F gatcttgatcttcattgtgctggg R tcgtcaccaactgggacgacatgg |
752 | 55 |
