Table 1. Conserved miRNAs shown to be expressed from T. aestivum chromosome 1AL.

miRNA from chromosome 1AL				Conserved miRNA1	Mature miRNA location			Pre-miRNA statistics				Matched sequence read2
ID	Sequence3	Length(nt)		ID	Start	End	Arm	Length	MFE4	GC%	MFEI5	ID
tae-miR171a	UGAUUGAGCCGCGCCAAUAU		20	zma-miR171a	78	97	3′	118	−59	48.31	1.04	F003IAL01BBGXU
tae-miR393a	UCCAAAGGGAUCGCAUUGAUCC		22	bdi-miR393a	20	41	5′	130	−66	53.08	0.95	F2MIQBM01BALL6
tae-miR399b	UGCCAAAGGAGAAUUGCCCUG		21	bdi-miR399b	120	140	3′	161	−64	57.14	0.69	F1NBZEY01AK17M
tae-miR399b	UGCCAAAGGAGAAUUGCCCUG		21	bdi-miR399b	111	131	3′	152	−64	57.89	0.73	F1NBZEY02GW67Y
tae-miR5075	GCCUCCGUCGCCGCCGUCCGC		21	osa-miR5075	20	40	5′	308	−147	69.16	0.69	F0RUNSI01CTDLK
tae-miR5050	AUGAGGUCGUUCAACCAGCAA		21	hvu-miR5050	92	112	3′	133	−72	60.90	0.89	F1ADE5F01D2FWK
tae-miR5050	GUGAGGUCGUUCAACCGGCAA		21	hvu-miR5050	92	112	3′	133	−75	60.90	0.92	F1ADE5F01D2FWK
tae-miR5200	UGUAGAUACUCCCUAAGGCUU		21	bdi-miR5200	76	96	3′	117	−39	38.46	0.86	F2MIQBM01ARRO6

¹Where two similar known miRNAs gave equally close matches to a sequence, the evolutionarily closest match is given.

²Matched sequence reads shown in bold were also predicted to form miRNA hairpins by miRPara.

³Mismatches to the conserved miRNA sequence are underlined and in bold.

⁴MFE  =  Minimum Folding free Energy of predicted hairpin secondary structure.

⁵MFEI  =  Minimum Folding Energy Index, calculated as described by Yin et al. [40].