Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequence for retroviral construct cloning.
| Name | Primer sequence | Restriction enzyme |
|---|---|---|
| HOXA9-F-MSCV-PIG | atactcgagatggccaccactggggc | XhoI |
| HOXA9-R-MSCV-PIG | accgaattctcactcgtcttttgctc | EcoRI |
| HOXA9-F-MSCVneo | atagaattcatggccaccactggggc | EcoRI |
| HOXA9-R-MSCVneo | accctcgagtcactcgtcttttgctc | XhoI |
| MEIS1-F-MSCVneo | atagaattcatggcgcaaaggtac | EcoRI |
| MEIS1-R-MSCVneo | ggcctcgagtagatgaaggttaca | XhoI |
