Table 4.
Sequence, template and length of forward and reverse primer.
| Primer | Sequence (5’-3’) | Template | Length | Tm (°C) |
|---|---|---|---|---|
| Forward Reverse |
AGGGCTGTATGGCCTCTGTCT GAAGGAGGCCTGGCGTAGTG |
1470–1490 2097–2078 |
21 20 |
56.65 56.78 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.