Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences
| Primer | Sequence | Length (bp) | AT (°C) |
|---|---|---|---|
| 18S | cggctaccacatccaaggaa | 187 | 60 |
| gctggaattaccgcggct | |||
| Gfap | cagatgatggagctcaatgacc | 379 | 60 |
| ctggatctcctcctccagcga | |||
| Plp | tggcgactacaagaccacca | 115 | 60 |
| gacacacccgctccaaagaa | |||
| Ccl2 | ttaaaaacctggatcggaaccaa | 120 | 60 |
| gcattagcttcagatttacgggt | |||
| Ccl3 | ttctctgtaccatgacactctgc | 99 | 62 |
| cgtggaatcttccggctgtag |
