Skip to main content
NCBI home page
The Journal of Nutrition logoLink to The Journal of Nutrition
. 2008 Dec;138(12):2379–2385. doi: 10.3945/jn.108.090993

3,3′-Diindolylmethane and Genistein Decrease the Adverse Effects of Estrogen in LNCaP and PC-3 Prostate Cancer Cells1,2

Sunyata Smith 3,4, Daniel Sepkovic 5, H Leon Bradlow 5, Karen J Auborn 3,4,*
PMCID: PMC3415863  PMID: 19022961

Abstract

Evidence suggests that 17β-estradiol (E2) contributes to the risk of prostate cancer (PCa), whereas the phytochemicals genistein from soy and 3,3′-diindolylmethane (DIM), derived from indole-3-carbinol in cruciferous vegetables, decrease the risk of PCa. This study examined the potential of these phytochemicals to reduce the adverse effects of E2 on PCa. In LNCaP PCa cells (E2 sensitive), DIM decreased E2-induced proliferation. Genistein increased proliferation at low concentrations and decreased proliferation at higher concentrations; DIM abolished the increased proliferation by genistein. The E2 stimulation in LNCaP cells was consistent with dependence on the androgen receptor, as evidenced by the inhibition of E2-induced proliferation with the antiandrogen casodex, E2 stimulation of an androgen response element luciferase reporter, and E2 stimulation of prostate-specific antigen (PSA) protein expression. Both genistein and DIM abrogated the E2 stimulation of PSA. Genistein and DIM altered major E2 metabolism pathways in LNCaP and PC-3 (E2 insensitive) PCa cells by increasing the expression of the 2-hydoxylation enzyme cytochrome P450 1A1 (CYP1A1) and the O-methylating enzyme catechol-o-methyltransferase (COMT) as determined by real-time RT-PCR. The increase in COMT mRNA occurred only when the combination of DIM and genistein (15 μmol/L) was used. Quantitation by MS indicated increased 2-hydroxyestrogen and decreased 16α-hydroxyestrone, a result that should result in less estrogenicity and increased amounts of the anticancer metabolite 2-methoxyestrone. We conclude that DIM and genistein decrease the effects of E2 that have the potential to promote PCa.

Introduction

It is clear that androgens are a major cause of prostate cancer (PCa).6 However, current evidence suggests that estrogen [17β-estradiol (E2) and its metabolites] is also a contributing factor [reviewed in references (1,2)]. It is well known that the incidence of PCa rises exponentially with increasing age. However, testosterone levels decline with increasing age, whereas E2 levels remain relatively unchanged (3–5), leading to an E2-dominant environment that contributes to prostate carcinogenesis (5,6). Additionally, African American men, who have the highest incidence of PCa in the United States, have serum E2 levels that are consistently higher than those in the general population but similar testosterone levels (7), whereas Japanese men have lower circulating E2 levels and a lower risk of PCa (8). In vitro, studies show that E2 increases proliferation in human PCa cells (9) and stimulates carcinoma in situ and adenocarcinoma in the prostates of rats and aging dogs (1,5,10,11). Furthermore, E2 metabolism has been shown to play a key role in prostate carcinogenesis [reviewed in (12)].

Lifestyle changes such as diet reduce or delay PCa. Genistein, a major soy isoflavone, and 3,3′-diindolylmethane (DIM), a major bioactive derivative of the dietary phytochemical indole-3-carbinol (I3C) from cruciferous vegetables, reduce the risk of PCa. Studies indicate that men whose diets are rich in soy (13,14) or cruciferous vegetables (15,16) have lower incidences of PCa. Laboratory studies, including translational studies, support the benefit of genistein, I3C, and DIM in providing a protective effect against PCa.

Genistein inhibits the growth of both androgen-dependent (17,18) and androgen-independent human PCa cell lines (18,19) and can protect against chemically induced and spontaneously developing PCa in rodent models (20,21). In clinical studies, soy isoflavone supplementation prevents or decreases the rate of increase in prostate-specific antigen (PSA) levels in patients with PCa (22).

Likewise, I3C and DIM have potent antiproliferative effects in human PCa cells (23,24). In vivo, DIM inhibits tumor cell development, decreases cell proliferation, and induces apoptosis of prostate tumor cells (25). These findings are consistent with the observed protective effects of cruciferous vegetables in relation to PCa (16).

DIM and genistein have the ability to diminish the effects of E2 in hormone-related cancers. Previous studies in our laboratory demonstrated that both I3C and genistein decrease E2 signaling and that the effect is synergistic when these nutrients are used in combination (26). Furthermore, both nutrients favorably alter E2 metabolism away from the production of estrogenic and potentially carcinogenic estrogen metabolites (27,28). Taken together, these findings suggest that DIM and genistein may have the potential to reduce the negative effects of E2 on PCa.

Although some mechanisms by which these phytochemicals protect against PCa have been demonstrated, the ability of these nutrients to affect the impact of E2 on PCa has not been investigated, nor has the combined effect of these compounds on PCa been determined. This study investigated the effects of DIM and genistein individually and together on E2-induced proliferation, E2-induced gene expression, and estrogen metabolism in PCa cell lines.

Materials and Methods

Reagents

E2, 2-methoxyestrone, and genistein were purchased from Sigma. DIM was a gift from Dr. M. Zeligs (Bioresponse). Casodex (CSDX) was obtained from AstraZeneca.

Cell lines and cell culture

The human prostate adenocarcinoma cell lines LNCaP and PC-3 were obtained from the American Type Culture Collection. All cells were maintained as monolayer cultures at 37°C in 5% CO2 and were grown in RPMI-1640 medium with glutamine (GIBCO-BRL) supplemented with 10% (v:v) fetal bovine serum (FBS) (HyClone Laboratories), 100 kU/L each of penicillin and streptomycin, and 200 mmol/L glutamine.

Cell proliferation assays

Cell proliferation was determined by the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation assay (Promega). Cells were seeded into 96-well plates at a density of 2000 cells per well in DMEM:F12(1:1) phenol red-reduced media (GIBCO-BRL) supplemented with 2% charcoal-dextran-treated FBS (HyClone Laboratories). After 5 d, the cells were treated in separate experiments with the following: vehicle control (dimethylsulfoxide), E2, CSDX, DIM, or genistein. Cell growth was assayed after 7 d (according to the manufacturer's instructions). The absorbance at 490 nm was measured with Emax precision microplate reader and analyzed using SoftMax Pro software. Eight replicates per condition were assayed and data averaged from 3 separate experiments are presented.

Androgen-response element–modulated transcription activity

To assess the effects of E2 on androgen-response element (ARE)–modulated transcription activity, analysis of luciferase reporter gene expression under control of ARE was performed. LNCaP cells (1 × 105 cells per well) were plated in 24-well plates in DMEM:F12(1:1) phenol red-reduced media supplemented with 2% charcoal-dextran–treated FBS and 24 h later they were transfected with the luciferase reporter vector (Translucent AR reporter vector, pAR-Luc,). We used the FuGENE 6 Transfection Reagent from Roche to transfect pAR-Luc into LNCaP cells according to the manufacturer's instructions. Experiments used 1 μg of pAR-luc for transfection and 0.02 μg of the renilla luciferase reporter plasmid pRL-TK (Promega) for normalization of transfection efficiency. Twenty-four h later the cells were treated with increasing concentrations of E2 (0, 1, and 100 nmol/L) for 48 h and then harvested for reporter gene assay with the dual luciferase reporter gene assay (Promega) according to the manufacturer's instructions. Six replicates per condition were assayed and data averaged from 3 separate experiments are presented.

Prostate-specific antigen protein assay

LNCaP cells were seeded into 24-well plates at a density of 2.5 × 104 cells per well in DMEM:F12 (1:1) phenol red-reduced media (GIBCO-BRL) supplemented with 2% charcoal-dextran–treated FBS (Hyclone Laboratories) and allowed to attach for 24 h. Two d later, cells were treated with E2 and/or various concentrations of DIM and/or genistein for 5 d. After 5 d, the medium was collected from the treated cells and PSA protein concentrations were determined utilizing the Human PSA ELISA kit (Anogen). In the assay, the medium samples were incubated in 96 wells following the manufacturer's instructions. The absorbance at 450 nm was measured with an Emax precision microplate reader and analyzed using SoftMax Pro software. PSA values were then normalized to total protein utilizing the Micro BCA Protein Assay Reagent kit (Pierce). Six replicates per condition were assayed and data averaged from 3 separate experiments are presented.

RNA extraction and real-time quantitative RT-PCR

Total RNA was extracted from cell lines using the RNAeasy mini kit (Qiagen) with DNase treatment to remove any traces of genomic DNA. The relative expression of mRNA was determined using the Eurogentec RTqPCR mastermix (Eurogentec) and ABI PRISM 7700 Sequence Detection system (PE Biosystems). The PCR mix contained 1× master mix and 0.125 μL of Euroscript + RT and RNase inhibitor (RT-0.125 U/μL and RNase inhibitor 0.05 U/μL). Taqman primers and probes were added at a final concentration of 500 nmol/L and 100 nmol/L, respectively. One hundred ng of total RNA was used per reaction in a 25-μL reaction volume. All samples were analyzed in duplicate. The thermal cycler conditions were 48°C for 30 min, 95°C for 10 min, and 45 cycles of 95°C for 0.15 min and 60°C for 1 min. Data were analyzed using Sequence Detection System software version 1.9.1. Results were obtained as threshold cycle (Ct) values. Ct is inversely proportional to the starting template copy number. β-Actin was used as reference gene and normalizer. Relative mRNA expression levels in samples treated with DIM and genistein were calculated compared with untreated control samples using the ΔΔ Ct method (user bulletin no. 2, Applied Biosystems). Results are expressed as fold of the experimental control (dimethylsulfoxide). For cytochrome P450 1A1 (CYP1A1), the forward primer was 5′AGCGAAGTGTATCGGTGAGA, the reverse was 5′AATTCCACCCGTTGCAGC, and the TaqMan probe was 5′CATTGCCCGCTGGGAGGTCTTTCT. For catechol-o-methyltransferase (COMT), the forward primer was 5′CTACTGGCTGACAACGTGATCTG, the reverse primer was 5′GTATTCCAGGAACGATTGGTAGTGT, and the TaqMan probe was 5′TGCGCCAGACTTCCTAGCACACGTG. Four replicates per condition were assayed and data averaged from 3 separate experiments are presented.

GC/MS analysis of estrogen metabolites

Sample preparation for estrogen metabolite determinations.

A 5-mL aliquot of media was diluted 1:1 with sodium acetate buffer (pH 4.65) and 20 μL of β-glucuronidase (110.2 mU/L) (Sigma). The solution was incubated at 40°C for 24 h to deconjugate the steroids. After the addition of deuterated estradiol (29), each sample was vortexed, extracted with chloroform, and evaporated completely. Each sample was derivitized by adding 10 μL of dry pyridine and 40 μL of bis(trimethylsilyl)trifluoroacetamide, vortexed, and allowed to react at room temperature overnight. One μL of each sample was injected into the GC-MS without further treatment.

GC-MS conditions.

An Agilent Technologies 6980N gas chromatograph equipped with an Agilent 5973 mass selective detector, an Agilent 7683 injector, and an HP G1701CA MSD Chemstation was used for the analysis of E2 and selected metabolites [2-hydroxyestrogen (2-OHE2) and 16α-hydroxyestrone (16α-OHE1)]. The method was modified from that of Adlercreutz et al. (30–33). Each of the above steroids was quantified using a 6-point calibration curve that ranged from 1 to 100 ng. Four replicates per condition were assayed and data averaged from 3 separate experiments are presented.

Statistical analysis

Statistical analysis was performed with GraphPad Prism and the data were analyzed by 1-way ANOVA with Tukey's post hoc comparisons. Data are expressed as means ± SD and differences were considered significant at P < 0.05.

Results

The effect of DIM and genistein on estrogen-induced proliferation in LNCaP cells.

E2 dose-dependently increased the proliferation of LNCaP cells (Fig. 1A) in accordance with results by others (9), but E2 did not stimulate PC-3 cells (P > 0.05; data not shown). A direct cell count study was equivalent to the results of the MTS cell proliferation assay measurement (results not shown).

FIGURE 1 .

FIGURE 1 

Open in a new tab

Growth of LNCaP cells treated with E2 (0, 1, 10, 100, and 1000 nmol/L) (A) or 10 nmol/L E2 and 0–15 μmol/L DIM and/or genistein (B) for 7 d. The untreated controls were set to 1. Values are means ± SD, n = 3. Means without a common letter differ, P < 0.05.

DIM decreased (P < 0.0001) E2-enhanced proliferation at all concentrations (5, 10, 15 μmol/L) (Fig. 1B). Treatment with the phytoestrogen genistein was more complicated. Genistein enhanced (P = 0.02) proliferation at 5 μmol/L but decreased the E2-enhanced proliferation at 10 μmol/L (P < 0.0001) and 15 μmol/L (P < 0.0001) (Fig. 1B). DIM (5 μmol/L) completely abolished the proliferative effect of genistein (5 μmol/L) (Fig. 1B).

Estradiol stimulates the androgen receptor in LNCaP PCa cells.

E2 can bind the androgen receptor (AR) in LNCaP cells and some other PCa lines due to mutations in the AR (34,35). Our results indicated that the E2 stimulation of proliferation involved the AR for a number of reasons. First, both RNA coding for the AR and the AR protein were abundantly expressed in LNCaP cells but not PC-3 cells (data not shown). Second, the antiandrogen compound CSDX, which binds to the AR, inhibited E2 stimulation of proliferation in LNCaP cells (Fig. 2A). Third, E2 increased expression of luciferase driven by the ARE and the endogenous AR (Fig. 2B). Finally, E2 increased the mRNA (P < 0.05; data not shown) and protein expression of PSA (Fig. 2C), which is an androgen-regulated gene. These results are consistent with E2 acting as an agonist for the AR.

FIGURE 2 .

FIGURE 2 

Open in a new tab

LNCaP cells treated with E2. Cell growth in the presence or absence of CSDX (10 μmol/L) (A). (B) ARE-driven luciferase. (C) PSA protein expression. The untreated controls were set to 1. Values are means ± SD, n = 3. *Different from control (E2-treated cells), P < 0.05. Means without a common letter differ, P < 0.05.

DIM and genistein decrease estrogen-induced PSA protein expression.

PSA is currently the most widely used tumor marker for PCa; increased levels of PSA correlate with an increased risk for developing PCa (36). Because E2 induced PSA gene (data not shown) and protein expression in LNCaP cells (Fig. 2C), we asked whether DIM and genistein inhibited this E2-induced expression. Both DIM and genistein significantly decreased estrogen-enhanced PSA protein expression at all concentrations (5, 10, and 15 μmol) (Fig. 3). DIM with or without genistein restored PSA protein expression to the baseline level (level without E2 enhancement) (Fig. 3).

FIGURE 3 .

FIGURE 3 

Open in a new tab

PSA protein expression in LNCaP cells treated with 10 nmol/L E2, DIM, and /or genistein. The untreated control was set to 1. Values are means ± SD, n = 3. Means without a common letter differ, P < 0.05.

DIM and genistein alter E2 metabolism in LNCaP and PC-3 cells.

E2 metabolism can have favorable or detrimental effects on carcinogenesis, due to the different activities of the E2 metabolites that are generated (see Fig. 4). Moreover, E2 metabolism is independent of the steroid receptors, so both hormone-dependent as well as hormone-independent cancers could be affected. Because both DIM and genistein favorably alter E2 metabolism in other types of cancer (27,28), we hypothesized that they should have a positive effect on E2 metabolism in PCa cells. Utilizing quantitative real time RT-PCR, we found that both DIM and genistein increased the mRNA expression of CYP1A1 in LNCaP and PC-3 cells after 18 h of treatment (Table 1). The effect of the combination of the 2 phytochemicals was better than either alone. The combination of 15 μmol/L DIM and 15 μmol/L genistein significantly increased COMT mRNA expression in both cell lines, but neither alone increased expression of this enzyme (Table 1). However, at higher concentrations (25–50 μmol/L), both of these phytochemicals alone increased COMT mRNA expression in these cell lines (P < 0.05; data not shown). To determine whether changes in the mRNA expression of the E2 metabolizing enzymes correlated with changes in the E2 metabolites themselves, we measured the amount of the E2 metabolites 2-OHE2 and 16α-OHE1 that were secreted by LNCaP and PC-3 cells after treatment with DIM and/or genistein utilizing MS. The combination of DIM and genistein increased secretion of 2-OHE2 in LNCaP and PC-3 cells, a result that correlates with the increased CYP1A1 mRNA expression (Fig. 5A,B). Additionally, both DIM and genistein decreased estrogenic and carcinogenic 16α-OHE1 in PC-3 cells (P < 0.05; data not shown). This metabolite was not detected in LNCaP cells. Expression of CYP1B1 was increased by DIM (P < 0.05; results not shown), which could increase carcinogenic 4-hydroxyestrogen. However, no increase in this metabolite was observed in LNCaP and PC-3 cells (results not shown).

FIGURE 4 .

FIGURE 4 

Open in a new tab

Cartoon of E2 metabolism. 4-OHE, 4-hydroxyestrogen; 2-ME, 2-methoxyestrogen; E1, estrone.

TABLE 1.

The effects of DIM and/or genistein on CYP1A1 and COMT mRNA in LNCaP and PC-3 cells after 18h of treatment

Phytochemical concentration CYP1A1
 COMT
LNCaP cells PC-3 cells LNCaP cells PC-3 cells
Fold of control
Control (0 DIM, 0 G)2 1.00 ± 0.0a 1.00 ± 0.0a 1.00 ± 0.0a 1.00 ± 0.0a
5 DIM 19.21 ± 0.65a 10.7 ± 1.76a 0.86 ± 0.01a 0.78 ± 0.27a
10 DIM 30.40 ± 3.31a 14.63 ± 3.25b 0.96 ± 0.28a 0.92 ± 0.11a
15 DIM 43.13 ± 12.95b 13.66 ± 0.93b 1.34 ± 0.13a 1.55 ± 0.11a
5 G 1.7 ± 0.27a 1.13 ± 0.29a 0.95 ± 0.28a 0.96 ± 0.21a
10 G 2.55 ± 0.04a 1.47 ± 0.21a 1.18 ± 0.33a 1.03 ± 0.10a
15 G 4.20 ± 0.11a 1.33 ± 0.33a 1.02 ± 0.24a 1.80 ± 0.07a
5 DIM, 5 G 31.73 ± 8.46a 20.04 ± 3.96c 1.28 ± 0.25a 1.21 ± 0.06a
10 DIM, 10 G 66.65 ± 5.68c 31.60 ± 6.80d 1.06 ± 0.01a 1.35 ± 0.01a
15 DIM, 15 G 106.81 ± 19.62d 26.74 ± 0.61c,d 4.42 ± 0.19b 1.98 ± 0.11b
Open in a new tab

1 Values are means ± SD, n = 3. Means in a column with superscripts without a common letter differ, P < 0.05 (Tukey's test).

2

G, genistein.

FIGURE 5 .

FIGURE 5 

Open in a new tab

E2 metabolites in LNCaP and PC-3 cells treated with 1 μmol/L E2, DIM, and/or genistein. (A) 2-OHE2 in LNCaP cells. (B) 2-OHE2 in PC-3 cells. Values are means ± SD, n = 3. Means without a common letter differ, P < 0.05.

2-Hydroxylated estrogens are rapidly O-methylated by COMT to generate 2-methoxyestrone or 2-methoxyestradiol (proapototic as well as antiproliferative compounds). Whereas most of our analysis did not assay for the O-methylated compounds, a single assay did detect 2-methyoxyestradiol in PC-3 cells after treatment with the nutrients (data not shown). In accordance with previous results (37), we found that 2-methyoxyestrone increased apoptosis in both cell lines (P < 0.05; data not shown).

Discussion

Diets containing DIM and genistein reduce the risk of PCa. This study demonstrated that these phytochemicals, at least in combination, counteract the adverse effects of E2 by decreasing E2-induced proliferation and E2-induced PSA expression. Additionally, both phytochemicals drove E2 metabolism toward 2-hydroxylation and O-methylation in both the E2-sensitive LNCaP cells and the E2-insensitive PC-3 cells, a result that should decrease proliferation, decrease angiogenesis, and increase apoptosis.

Genistein, a phytoestrogen, has known E2 activity. Our results mimicked those in breast cancer cells in that low concentrations of genistein stimulated growth and higher concentrations inhibited growth (38). However, low concentrations of genistein (5 μmol/L) did cause a significant reduction in E2-induced PSA protein expression, indicating that low concentrations of genistein do in fact reduce the adverse effects of E2 on PCa. If genistein truly has a proliferative effect in regards to PCa, then DIM at low concentrations abrogates any proliferative effects caused by genistein when they are used in combination.

The sex-hormone receptor status of the prostate, with respect to PCa, is complicated. In the prostate, AR and estrogen receptors (ER) are expressed and all seem to play a key role in prostate carcinogenesis (39–42). The E2 stimulation of proliferation in LNCaP cells and, conversely, its inhibition by DIM and genistein, appeared to be related to the AR. This was evident by the fact that the LNCaP cells used in this study did not express either ERα or ERβ, albeit we did detect ERβ (but not ERα) in LNCaP cells from another laboratory (data not shown). It is not uncommon for cells to lose expression of their ER (43–45); loss of receptor expression is one of the most important steps in acquiring hormone resistance (46,47). Although, the ER were not expressed in the LNCaP cells, the cells did abundantly express the AR, which contains mutations allowing it to be stimulated by E2 (34,35). Our studies were consistent with E2 stimulation being related to the AR. More PCa lines are being identified with mutated AR that respond to E2 (35,48). One can postulate that a selection for E2-sensitive AR occurs due to the increasing estrogenization of older males. In these studies, DIM and genistein reduced the stimulatory effects of E2. In the case of DIM, this decreased stimulatory effect may be due to its ability to bind to the AR (49), leading to decreased proliferation and PSA expression. Although genistein does not bind to the AR, it may accomplish these same results via its ability to cause downregulation of the AR (50). In addition to the AR, studies by others indicate that both ERα and ERβ are involved in prostate carcinogenesis [reviewed in (2,41,42,51,52)]. Although not applicable to this study, our previous studies indicate that I3C, the precursor to DIM, and genistein (synergistic together) are negative regulators of ERα (26), suggesting that both phytochemicals have the ability to provide a protective effect against the negative effects of E2 that are related to the ER. Putting this information together, DIM and genistein should downregulate E2 stimulation by both the AR and ER.

A clear link between E2 metabolism and prostate carcinogenesis exists (12,53,54). E2 metabolism is independent of the ER and AR, and modulation of E2 metabolism by DIM and genistein could have a positive affect on any prostate cell regardless of its hormone status, resulting in a reduction of carcinogenic estrogen metabolites and generation of metabolites that are antiproliferative, proapoptotic, and antiangiogenic. Both DIM and genistein increase the expression of CYP1A1 and COMT in other systems and increase 2-hydroxylation in vivo (27,28,55). In this study, we showed that DIM and genistein increased expression of these enzymes in PCa cells. We also showed that both phytochemicals increase 2-OHE2, which has weak estrogenic activity (56) and is rapidly O-methylated, while simultaneously decreasing 16α-OHE1, which has prolonged estrogenic activity (57,58). The implications of these favorable alterations in estrogen metabolism in PCa has been documented in vivo. For example, a case control study of urinary estrogen metabolites and PCa indicated that elevated 2-OHE2 urinary levels are associated with a reduced risk of developing PCa, whereas elevated 16α-OHE1 urinary levels are associated with an increased risk of PCa (53).

This study further supports the notion that DIM and genistein will help efforts against PCa, showing that both these phytochemicals diminish adverse effects of E2. Effective concentrations are difficult to compare in vitro vs. in vivo and further studies are needed to determine which in vitro concentrations of these phytochemicals would be most beneficial. Importantly, our combination studies indicate that much lower concentrations of the phytochemicals can be used to achieve a favorable outcome. DIM is known to concentrate in tissues after administration (59) and recent clinical studies reveal that significant elevations of intraprostatic genistein can be achieved with short-term dietary phytoestrogen supplementation (60). Together, the implication is that it should be possible to achieve concentrations of DIM and genistein, especially in combination, that would be beneficial in clinical chemopreventative strategies targeting PCa.

Acknowledgments

We thank Dr. Shishinn Sun for his helpful and critical comments during the course of the study, Dr. Kai Liu for his technical assistance, and Dr. Timothy Carter and Shyria Barker for a critical reading of this manuscript.

1

Supported by NIH grant CA100967 (to K. J. Auborn).

2

Author disclosures: S. Smith, D. Sepkovic, H. L. Bradlow, and K. J. Auborn, no conflicts of interest.

6

Abbreviations used: AR, androgen receptor; ARE, androgen response element; COMT, catechol-o-methyltransferase; CSDX, casodex; Ct, threshold cycle; CYP1A1, cytochrome P50 1A1; DIM, 3,3′-diindolylmethane; ER, estrogen receptor; E2, 17β-estradiol; FBS, fetal bovine serum; I3C, indole-3-carbinol; PCa, prostate cancer; PSA, prostate-specific antigen; 2-OHE2, 2-hydroxyestrogen; 16α-OHE1, 16α-hydroxyestrone.

References

  • 1.Ho SM. Estrogens and anti-estrogens: key mediators of prostate carcinogenesis and new therapeutic candidates. J Cell Biochem. 2004;91:491–503. [DOI] [PubMed] [Google Scholar]
  • 2.Ellem SJ, Risbridger GP. Treating prostate cancer: a rational for targeting local oestrogens. Nat Rev Cancer. 2007;7:621–7. [DOI] [PubMed] [Google Scholar]
  • 3.Risbridger GP. Androgens vs estrogens in prostate cancer. Endrocrine Abstracts. 2003;5:S7. [Google Scholar]
  • 4.Griffiths K. Estrogens and prostatic disease. Prostate. 2000;45:87–100. [DOI] [PubMed] [Google Scholar]
  • 5.Steiner MS, Raghow S, Neubauer B. Selective estrogen receptor modulators for the chemoprevention of prostate cancer. Urology. 2001;57:68–72. [DOI] [PubMed] [Google Scholar]
  • 6.Krieg M, Nass R, Tunn SS. Effect of aging on endogenous level of 5α-dihydrotestoterone, testosterone, estradiol, and estrone in epithelium and stroma of normal and hyperplastic human prostate. J Clin Endocrinol Metab. 1993;77:375–81. [DOI] [PubMed] [Google Scholar]
  • 7.Rohrmann S, Nelson WG, Rifai N, Brown TR, Dobs A, Kanarek N, Yager JD, Platz EA. Serum estrogen, but not testosterone, levels differ between black and white men in a nationally representative sample of Americans. J Clin Endocrinol Metab. 2007;92:2519–25. [DOI] [PubMed] [Google Scholar]
  • 8.Bosland MC. The role of steroid hormones in prostate carcinogenesis. J Natl Cancer Inst Monogr. 2000;27:39–66. [DOI] [PubMed] [Google Scholar]
  • 9.Arnold JT, Le H, McFann KK, Blackman MR. Comparative effects of DHEA vs. testosterone, dihydrotestosterone, and estradiol on proliferation and gene expression in human LNCaP prostate cancer cells. Am J Physiol Endocrinol Metab. 2005;288:E573–84. [DOI] [PubMed] [Google Scholar]
  • 10.Wang Y, Hayward SW, Donjacour AA, Young P, Jacks T, Sage J, Dahiya R, Cardill RD, Day ML, et al. Sex hormone-induced carcinogenesis in Rb-deficient prostate tissue. Cancer Res. 2000;60:6008–17. [PubMed] [Google Scholar]
  • 11.Walsh PC, Wilson JD. The induction of prostatic hypertrophy in dog with androstanediol. J Clin Invest. 1976;57:1093–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lord RS. Estrogen metabolism and the diet-cancer connection: rational for assessing the ratio of urinary hydroxylated estrogen metabolites-estrogen metabolism/cancer review. Altern Med Rev. 2002;7:112–29. [PubMed] [Google Scholar]
  • 13.Nagata Y, Sonoda T, Mori M, Miyanaga N, Okumura K, Goto K, Naito S, Fujimoto K, Hirao Y, et al. Dietary isoflavones may protect against prostate cancer in Japanese men. J Nutr. 2007;137:1974–9. [DOI] [PubMed] [Google Scholar]
  • 14.Lee MM, Gomez SL, Chang JS, Wey M, Wang RT, Hsing AW. Soy and isoflavone consumption in relation to prostate cancer risk in China. Cancer Epidemiol Biomarkers Prev. 2003;12:665–8. [PubMed] [Google Scholar]
  • 15.Kirsh VA, Peters U, Mayne ST, Subar AF, Chatterjee N, Johnson CC, Hayes RB. Prostate, lung, colorectal and ovarian cancer screening trail. Prospective study of fruit and vegetables intake and risk of prostate cancer. J Natl Cancer Inst. 2007;99:1200–9. [DOI] [PubMed] [Google Scholar]
  • 16.Cohen JH, Kristal AR, Stanford JL. Fruit and vegetable intakes and prostate cancer risk. J Natl Cancer Inst. 2000;92:61–8. [DOI] [PubMed] [Google Scholar]
  • 17.Onozawa M, Fukuda K, Ohtani M, Akaza H, Sugimura T, Wakabayashi K. Effects of soybean isoflavones on cell growth and apoptosis of the human prostatic cell line LNCaP. Jpn J Clin Oncol. 1998;28:360–3. [DOI] [PubMed] [Google Scholar]
  • 18.Santibanez JF, Navarro A, Martinez J. Genistein inhibits proliferation and in vitro invasive potential of human prostatic cancer cell lines. Anticancer Res. 1997;17:1199–204. [PubMed] [Google Scholar]
  • 19.Bhatia N, Agarwal R. Detrimental effect of cancer preventive phytochemicals silymarin, genistein and epigallocatechin 3-gallate on epigenetic events in human prostate carcinoma DU145 cells. Prostate. 2001;46:98–107. [DOI] [PubMed] [Google Scholar]
  • 20.Wang J, Eltoum IE, Lamartiniere CA. Dietary genistein suppress chemically-induced prostate cancer in Lound-Wistar Rats. Cancer Lett. 2002;186:11–8. [DOI] [PubMed] [Google Scholar]
  • 21.Mentor-Marcel R, Lamartiniere CA, Greenberg NM, Elagavish A. Genistein in the diet reduces the incidence of poorly differentiated prostatic adenocarcinoma in transgenic mice (TRAMP). Cancer Res. 2001;61:6777–82. [PubMed] [Google Scholar]
  • 22.Kumar NB, Cantor A, Allen K, Riccardi D, Besterman-Dahan K, Seigne J, Helal M, Salup R, Pow-Sang J. The specific role of isoflavones in reducing prostate cancer risk. Prostate. 2004;59:141–7. [DOI] [PubMed] [Google Scholar]
  • 23.Brignall MS. Prevention and treatment of cancer with indole-3-carbinol. Altern Med Rev. 2001;6:580–9. [PubMed] [Google Scholar]
  • 24.Nachshon-Kedmi M, Yannai S, Haj A, Fares FA. Indole-3-carbinol and 3′3-diindolylmethane induce apoptosis in human prostate cancer-cells. Food Chem Toxicol. 2003;41:745–52. [DOI] [PubMed] [Google Scholar]
  • 25.Nachshon-Kedmi M, Fares F, Yannai S. Therapeutic activity of 3′3-diindolylmethane on prostate cancer in an in vivo model. Prostate. 2004;61:153–60. [DOI] [PubMed] [Google Scholar]
  • 26.Auborn KJ, Fan S, Rosen EM, Goodwin L, Chandraskaren A, Williams DE, Chen D, Carter TH. Indole-3-carbinol is a negative regulator of estrogen. J Nutr. 2003;133:S2470–5. [DOI] [PubMed] [Google Scholar]
  • 27.Xu X, Duncan AM, Wangen KE, Kurzer MS. Soy consumption alters endogenous estrogen metabolism in postmenopausal women. Cancer Epidemiol Biomarkers Prev. 2000;9:781–6. [PubMed] [Google Scholar]
  • 28.Bradlow HL, Sepkovic DW, Telang NT, Osborn MP. Multifunctional aspects of the action of indole-3-carbinol as an antitumor agent. Ann N Y Acad Sci. 1999;889:204–13. [DOI] [PubMed] [Google Scholar]
  • 29.Dehennin L, Reiffsteck A, Scholler R. Simple methods for the synthesis of twenty different highly enriched deuterium labeled steroids suitable as internal standards for isotope dilution mass spectrometry. Biol Mass Spectrom. 1980;7:493–9. [Google Scholar]
  • 30.Sepkovic DW, Bradlow HL, Michnovicz J, Murtezani S, Levy I, Osborne MP. Catechol estrogen production in rat microsomes after treatment with indole-3-carbinol, ascorbigen, or B-napthaflavone: a comparison of stable isotope dilution gas chromatography-mass spectrometry and radiometric methods. Steroids. 1994;59:318–23. [DOI] [PubMed] [Google Scholar]
  • 31.Raju U, Sepkovic DW, Dixon JM, Bradlow HL, Levitz M. Estrone and estradiol metabolism in vivo in human breast cysts. Steroids. 2000;65:883–8. [DOI] [PubMed] [Google Scholar]
  • 32.Jellinck PH, Makin HLJ, Sepkovic DW, Bradlow HL. Influence of indole carbinols and growth hormone on the metabolism of 4-androstenedione by rat liver microsomes. J Steroid Biochem Mol Biol. 1993;46:791–8. [DOI] [PubMed] [Google Scholar]
  • 33.Adlercreutz H, Martin F, Wahlroos O, Soini E. Mass spectrometric and mass fragmentographic determination of natural and synthetic steroids in biological fluids. J Steroid Biochem. 1975;6:247–59. [DOI] [PubMed] [Google Scholar]
  • 34.Veldscholte J, Berrevoets CA, Ris-Stalpers C, Kuiper GC, Jenster G, Trapman J, Brinkmann AO, Mulder E. The androgen receptor in LNCaP cells contains mutation in the ligand binding domain which effect steroid binding characteristics and response to antiandrogens. J Steroid Biochem Mol Biol. 1992;41:665–9. [DOI] [PubMed] [Google Scholar]
  • 35.McDonald S, Brive L, Agus DB, Scher HI, Ely KR. Ligand responsiveness in human prostate cancer: structural analysis of mutant androgen receptors from LNCaP and CWR22 tumors. Cancer Res. 2000;60:2317–22. [PubMed] [Google Scholar]
  • 36.Han M, Gann PH, Catalona WJ. Prostate-specific antigen and screening for prostrate cancer. Med Clin North Am. 2004;88:245–65. [DOI] [PubMed] [Google Scholar]
  • 37.Bu S, Blaukat A, Fu X, Heldin NE, Landstrom M. Mechanisms for 2-methoxyestradiol-induced apoptosis of prostate cancer cells. FEBS Lett. 2002;531:141–51. [DOI] [PubMed] [Google Scholar]
  • 38.Hsieh CY, Santell RC, Haslam SZ, Helferich WG. Estrogenic effects of genistein on the growth of estrogen receptor-positive human breast cancer (MCF-7) cells in vitro and in vivo. Cancer Res. 1998;58:3833–8. [PubMed] [Google Scholar]
  • 39.Hara T, Miyazaki H, Lee A, Tran CP, Reiter RE. Androgen receptor and invasion in prostate cancer. Cancer Res. 2008;68:1128–35. [DOI] [PubMed] [Google Scholar]
  • 40.Suzuki H, Ueda T, Ichikawa T, Ito H. Androgen receptor involvement in the progression of prostate cancer. Endocr Relat Cancer. 2003;10:209–16. [DOI] [PubMed] [Google Scholar]
  • 41.Linja MJ, Savinainen KJ, Tammela TL, Isola JJ, Visakorpi T. Expression of ERalpha and ERbeta in prostate cancer. Prostate. 2003;55:180–6. [DOI] [PubMed] [Google Scholar]
  • 42.Lau KM, LaSpina M, Long J, Ho SM. Expression of estrogen receptor (ER)-alpha and ER-beta in normal and malignant prostatic epithelial cells: regulation by methylation and involvement in growth regulation. Cancer Res. 2000;60:3175–82. [PubMed] [Google Scholar]
  • 43.Horvath LG, Henshall SM, Lee CS, Head DR, Quinn DI, Makela S, Delprado W, Golovsky D, Brenner PC, et al. Frequent loss of estrogen receptor-beta expression in prostate cancer. Cancer Res. 2001;61:5331–5. [PubMed] [Google Scholar]
  • 44.Yoshida T, Eguchi H, Nakachi K, Tanimoto K, Higashi Y, Suemasu K, Iino Y, Morishita Y, Hayashi S. Distinct mechanisms of loss of estrogen receptor alpha gene expression in human breast cancer: methylation of the gene and alteration of trans-acting factors. Carcinogenesis. 2000;21:2193–201. [DOI] [PubMed] [Google Scholar]
  • 45.Ji Q, Liu PI, Elshimali Y, Stolz A. Frequent loss of estrogen and progesterone receptors in human prostatic tumors determined by quantitative real-time PCR. Mol Cell Endocrinol. 2005;229:103–10. [DOI] [PubMed] [Google Scholar]
  • 46.Katzenellenbogen BS, Montano MM, Ekena K, Herman ME, McInerney EM, William L. McGuire Lecture. Antiestrogens: mechanisms of action and resistance in breast cancer. Breast Cancer Res Treat. 1997;44:23–38. [DOI] [PubMed] [Google Scholar]
  • 47.Lykkesfeldt AE. Mechanisms of tamoxifen resistance in the treatment of advanced breast cancer. Acta Oncol. 1996;35:9–14. [DOI] [PubMed] [Google Scholar]
  • 48.Han G, Foster BA, Mistry S, Buchanan G, Harris JM, Tilley WD, Greenberg NM. Hormone status selects for spontaneous somatic androgen receptor variants that demonstrate specific ligand and cofactor dependent activities in autochthonous prostate cancer. J Biol Chem. 2001;276:11204–13. [DOI] [PubMed] [Google Scholar]
  • 49.Le HT, Schaldach CM, Firestone GL, Bjeldanes LF. Plant-derived 3–3′-diindolylmethane is a strong androgen antagonist in human prostate cancer cells. J Biol Chem. 2003;278:21136–45. [DOI] [PubMed] [Google Scholar]
  • 50.Bektic J, Berger AP, Pfeil K, Dobler G, Bartsch G, Klocker H. Androgen receptor regulation by physiological concentrations of the isoflavonoid genistein in androgen-dependent LNCaP cells is mediated by estrogen receptor β. Eur Urol. 2004;45:245–51. [DOI] [PubMed] [Google Scholar]
  • 51.Castagnetta LA, Miceli MD, Sorci CMG, Pfeffer U, Farruggio R, Oliveri G, Calabro M, Carruba G. Growth of LNCaP human prostate cancer cells is stimulated by estradiol via it's own receptor. Endocrinology. 1995;136:2309–19. [DOI] [PubMed] [Google Scholar]
  • 52.Prins GS, Birch L, Couse JF, Choi I, Katzenellenbogen B, Korack KS. Estrogen imprinting of the developing prostate gland is mediated through stromal estrogen receptor alpha: studies with alphaERKO and betaERKO mice. Cancer Res. 2001;61:6089–97. [PubMed] [Google Scholar]
  • 53.Muti P, Westerlind K, Wu T, Grimaldi T, Berry J, Freudenheim JL, Hill H, Carruba G, Bradlow L. Urinary estrogen metabolites and prostate cancer: a case control study in the United States. Cancer Causes Control. 2002;13:947–55. [DOI] [PubMed] [Google Scholar]
  • 54.Zhu BT, Conney AH. Functional role of estrogen metabolism in target cells: review and perspectives. Carcinogenesis. 1998;19:1–27. [DOI] [PubMed] [Google Scholar]
  • 55.Brueggemeier RW, Gu X, Mobley JA, Joomprabutra S, Bhat AS, Whetstone JL. Effects of phytoestrogens and synthetic combinatorial libraries on aromatase, estrogen biosynthesis and metabolism. Ann N Y Acad Sci. 2001;948:51–66. [DOI] [PubMed] [Google Scholar]
  • 56.Bradlow HL, Telang NL, Sepkovic DW, Osborn MP. 2-Hydroxyestrone: the “good” estrogen. J Endocrinol. 1996;150:s259–65. [PubMed] [Google Scholar]
  • 57.Swaneck GE, Fishman J. Covalent binding of the endogenous estrogen 16 alpha-hydroxyestrone to estradiol receptor in human breast cancer cells: characterization and intranuclear localization. Proc Natl Acad Sci USA. 1998;85:7831–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Telang NT, Suto A, Wong GY, Osborne MP, Bradlow HL. Induction by estrogen metabolite 16α-hroxyestrone genotoxic damage and aberrant proliferation in mouse mammary epithelial cells. J Natl Cancer Inst. 1992;84:634–8. [DOI] [PubMed] [Google Scholar]
  • 59.Anderton MJ, Manson MM, Verschoyle RD, Gescher A, Lamb JH, Farmer PB, Steward WP, Williams ML. Pharmacokinetics and tissue disposition of indole-3-carbinol and it's acid condensation products after oral administration to mice. Clin Cancer Res. 2004;10:5233–41. [DOI] [PubMed] [Google Scholar]
  • 60.Rannikko A, Petas A, Rannikko S, Adlercreutz H. Plasma and prostate phytoestrogen concentrations in prostate cancer patients after oral phytoestrogen supplementation. Prostate. 2006;66:82–7. [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Nutrition are provided here courtesy of American Society for Nutrition

RESOURCES