Table 1.

Published primers for amplification of C. difficile ISRs

Primer	Gene target	GenBank accession no.	Sequence (5′–3′)e	Tm (°C)
16S-USAa,d	16S rRNA gene	FN545816	12293 GTGCGGCTGGATCACCTCCT 12312	71.0
16S-UKb,d	16S rRNA gene	FN545816	12256 CTGGGGTGAAGTCGTAACAAGG 12277	66.6
16S-AUc	16S rRNA gene	FN545816	12297 GGCTGGATCACCTCCTT 12313	60.2
23S-USAa,d	23S rRNA gene	FN545816	12621 CCCTGCACCCTTAATAACTTGACC 12598	67.1
23S-UKb	23S rRNA gene	FN545816	12617 GCgCCCTTtgTAgCTTGACC 12598	67.9
23S-AUc,d	23S rRNA gene	FN545816	12638 TAGTGCCAAGGCATCCGCCCT 12618	73.6

^aBidet et al. (1) and Indra et al. (7).

^bStubbs et al. (16). Of note, reverse primer 23S-UK has a 4-nucleotide mismatch (lowercase) compared to 23S rRNA genes of four fully sequenced C. difficile PCR ribotype 027 genomes (Table 2).

^cSadeghifard et al. (13).

^dFor SCGE, primer pairs 16S-USA/23S-USA, 16S-UK/23S-UK, and 16S-UK/23S-AU were used, with forward primers 16S-UK and 16S-USA being 5′-FAM labeled; for QCGE, nonlabeled conventional primer pair 16S-UK/23S-AU was used.

^eNumbers indicate sequence positions in corresponding GenBank sequences. Theoretical size differences between PCR products amplified by different primer pairs versus 16S-USA/23S-USA were 32 bp for 16S-UK/23S-UK, 13 bp for 16S-AU/23S-AU, and 53 bp for 16S-UK/23S-AU.