Skip to main content
. 2012 Sep;50(9):2951–2963. doi: 10.1128/JCM.00860-12

Table 1.

Primers developed in this study, except primers for sequencing and detection of stx2 (50)a

Gene(s), primer use, and primer Sequence (5′–3′)b Position Amplicon size (bp) Comments
stx and stx1
    Sequencing
        stx1-seq-F1 ATGTCATTCGCTCTGCAATAGGTAC 119–143 1,020
        stx1-seq-R1 GAAGAAGAGACTGAAGATTCCATCTG 1,113–1,138
    Detection
        stx1-det-F1 GTACGGGGATGCAGATAAATCGC 440–462 209
        stx1-det-R1 AGCAGTCATTACATAAGAACGYCCACT 622–648
    Subtyping
        stx1a-F1 CCTTTCCAGGTACAACAGCGGTT 362–384 478 All 6 primers can be used in a triplex PCR for subtyping of stx/stx1c
        stx1a-R2 GGAAACTCATCAGATGCCATTCTGG 815–839
        stx1c-F1 CCTTTCCTGGTACAACTGCGGTT 362–384 252
        stx1c-R1 CAAGTGTTGTACGAAATCCCCTCTGA 588–613
        stx1d-F1 CAGTTAATGCGATTGCTAAGGAGTTTACC 50–78 203
        stx1d-R2 CTCTTCCTCTGGTTCTAACCCCATGATA 225–252
stx2
    Sequencing and detection
        F4 GGCACTGTCTGAAACTGCTCCTGT 606–629 627 For detection, all 4 primers can be used in one reaction; for sequencing, use F4 and R1 for all subtypes except stx2e and stx2f, which are sequenced with F4-f and R1-e/f
        R1 ATTAAACTGCACTTCAGCAAATCC 1,209–1,232
        F4-f CGCTGTCTGAGGCATCTCCGCT 606–629 625
        R1-e/f TAAACTTCACCTGGGCAAAGCC 1,209–1,230
    Subtyping
        stx2a-F2 GCGATACTGRGBACTGTGGCC 754–774
        stx2a-R3 CCGKCAACCTTCACTGTAAATGTG 1,079–1,102 349
        stx2a-R2 GCCACCTTCACTGTGAATGTG 1,079–1,100 347
        stx2b-F1 AAATATGAAGAAGATATTTGTAGCGGC 968–994 251
        stx2b-R1 CAGCAAATCCTGAACCTGACG 1,198–1,218
        stx2c-F1 GAAAGTCACAGTTTTTATATACAACGGGTA 926–955 177
        stx2c-R2 CCGGCCACYTTTACTGTGAATGTA 1,079–1,102
        stx2d-F1 AAARTCACAGTCTTTATATACAACGGGTG 927–955
        stx2d-R1 TTYCCGGCCACTTTTACTGTG 1,085–1,105 179d
        stx2d-O55-R TCAACCGAGCACTTTGCAGTAG 1,140–1,161 235
        stx2d-R2 GCCTGATGCACAGGTACTGGAC 1,184–1,206 280
        stx2e-F1 CGGAGTATCGGGGAGAGGC 695–713 411
        stx2e-R2 CTTCCTGACACCTTCACAGTAAAGGT 1,080–1,105
        stx2f-F1 TGGGCGTCATTCACTGGTTG 451–475 424
        stx2f-R1 TAATGGCCGCCCTGTCTCC 856–874
        stx2g-F1 CACCGGGTAGTTATATTTCTGTGGATATC 203–231 573
        stx2g-R1 GATGGCAATTCAGAATAACCGCT 771–793
a

PCR conditions are as described in the text below, except annealing temperatures, which were 56°C for sequencing and detection and 64°C to 66°C for the subtyping of stx/stx1 or stx2. Especially, the resolution of stx2a, stx2c, and stx2d may require individual calibration of thermocyclers. A well-defined single colony is inoculated in beef broth and incubated overnight at 37°C. One hundred microliters of broth is added to 900 μl of sterile H2O, placed in a heating block at 100°C for 15 min, and centrifuged at 18,000 × g for 5 min. Upon transfer to a clean tube, the supernatant is used directly for PCR and stored at −18°C for further analyses. For PCR, a total volume of 20 μl contains 2.5 μl H2O, 10 μl HotStarTaq Master Mix Kit (Qiagen), 1.25 μl of each of two primers (stock solution of primers is 5 μM) and 5 μl supernatant of boiled lysate (stock). The thermocycler conditions are 95°C for 15 min followed by 35 cycles of 94°C for 50 s, 56°C for sequencing and detection, and 64°C for subtyping for 40 s and 72°C for 60 s, ending with 72°C for 3 min. PCR amplicons are stored at 4°C. The final resolution of stx2a, stx2c, and stx2d may require calibration of individual brands of thermocyclers by testing annealing temperatures from 64°C to 66°C on the test panel of reference strains. In our hands, an additional PCR using the stx2d primers was run at an annealing temperature of 66°C. False-positive stx2c fragments disappeared and true stx2d-positive fragments persisted at this annealing temperature. A total volume (20 μl) for standard PCR contains 2.5 μl H2O [if three primers are used (stx2a), the H2O volume is reduced to 1.25 μl; if four primers are used (stx2d or detection of all stx2 variants), H2O is not added]; 10 μl Mastermix (HotStarTaq, Qiagen); 1.25 μl of each of two primers (stock solution of primers is 5 μM) [if three primers are used (stx2a), the H2O volume is reduced to 1.25 μl; if four primers are used (stx2d or detection of all stx2 variants), H2O is not added]; and 5 μl supernatant of boiled lysate (stock).

b

Wobble bases are shown in bold.

c

For triplex PCR for subtyping of stx1, a total volume of 25 μl contains 12 μl Mastermix (HotStarTaq, Qiagen), 1 μl of each of the four primers for stx1c and stx1d (stock solution of primers is 5 μM), 2 μl of each of two primers for stx1a (stock solution of primers is 5 μM), and 5 μl supernatant of boiled lysate (stock).

d

All three reverse primers in the same reaction will result in amplicons of 179 bp with nine stx2d variants, 235 bp with variant stx2d-O55-5905, 280 bp with five stx2d variants, and finally two amplicons of 179 bp and 280 bp with variant stx2d-O73-C165-02.