Table 1.
| Gene(s), primer use, and primer | Sequence (5′–3′)b | Position | Amplicon size (bp) | Comments |
|---|---|---|---|---|
| stx and stx1 | ||||
| Sequencing | ||||
| stx1-seq-F1 | ATGTCATTCGCTCTGCAATAGGTAC | 119–143 | 1,020 | |
| stx1-seq-R1 | GAAGAAGAGACTGAAGATTCCATCTG | 1,113–1,138 | ||
| Detection | ||||
| stx1-det-F1 | GTACGGGGATGCAGATAAATCGC | 440–462 | 209 | |
| stx1-det-R1 | AGCAGTCATTACATAAGAACGYCCACT | 622–648 | ||
| Subtyping | ||||
| stx1a-F1 | CCTTTCCAGGTACAACAGCGGTT | 362–384 | 478 | All 6 primers can be used in a triplex PCR for subtyping of stx/stx1c |
| stx1a-R2 | GGAAACTCATCAGATGCCATTCTGG | 815–839 | ||
| stx1c-F1 | CCTTTCCTGGTACAACTGCGGTT | 362–384 | 252 | |
| stx1c-R1 | CAAGTGTTGTACGAAATCCCCTCTGA | 588–613 | ||
| stx1d-F1 | CAGTTAATGCGATTGCTAAGGAGTTTACC | 50–78 | 203 | |
| stx1d-R2 | CTCTTCCTCTGGTTCTAACCCCATGATA | 225–252 | ||
| stx2 | ||||
| Sequencing and detection | ||||
| F4 | GGCACTGTCTGAAACTGCTCCTGT | 606–629 | 627 | For detection, all 4 primers can be used in one reaction; for sequencing, use F4 and R1 for all subtypes except stx2e and stx2f, which are sequenced with F4-f and R1-e/f |
| R1 | ATTAAACTGCACTTCAGCAAATCC | 1,209–1,232 | ||
| F4-f | CGCTGTCTGAGGCATCTCCGCT | 606–629 | 625 | |
| R1-e/f | TAAACTTCACCTGGGCAAAGCC | 1,209–1,230 | ||
| Subtyping | ||||
| stx2a-F2 | GCGATACTGRGBACTGTGGCC | 754–774 | ||
| stx2a-R3 | CCGKCAACCTTCACTGTAAATGTG | 1,079–1,102 | 349 | |
| stx2a-R2 | GCCACCTTCACTGTGAATGTG | 1,079–1,100 | 347 | |
| stx2b-F1 | AAATATGAAGAAGATATTTGTAGCGGC | 968–994 | 251 | |
| stx2b-R1 | CAGCAAATCCTGAACCTGACG | 1,198–1,218 | ||
| stx2c-F1 | GAAAGTCACAGTTTTTATATACAACGGGTA | 926–955 | 177 | |
| stx2c-R2 | CCGGCCACYTTTACTGTGAATGTA | 1,079–1,102 | ||
| stx2d-F1 | AAARTCACAGTCTTTATATACAACGGGTG | 927–955 | ||
| stx2d-R1 | TTYCCGGCCACTTTTACTGTG | 1,085–1,105 | 179d | |
| stx2d-O55-R | TCAACCGAGCACTTTGCAGTAG | 1,140–1,161 | 235 | |
| stx2d-R2 | GCCTGATGCACAGGTACTGGAC | 1,184–1,206 | 280 | |
| stx2e-F1 | CGGAGTATCGGGGAGAGGC | 695–713 | 411 | |
| stx2e-R2 | CTTCCTGACACCTTCACAGTAAAGGT | 1,080–1,105 | ||
| stx2f-F1 | TGGGCGTCATTCACTGGTTG | 451–475 | 424 | |
| stx2f-R1 | TAATGGCCGCCCTGTCTCC | 856–874 | ||
| stx2g-F1 | CACCGGGTAGTTATATTTCTGTGGATATC | 203–231 | 573 | |
| stx2g-R1 | GATGGCAATTCAGAATAACCGCT | 771–793 |
PCR conditions are as described in the text below, except annealing temperatures, which were 56°C for sequencing and detection and 64°C to 66°C for the subtyping of stx/stx1 or stx2. Especially, the resolution of stx2a, stx2c, and stx2d may require individual calibration of thermocyclers. A well-defined single colony is inoculated in beef broth and incubated overnight at 37°C. One hundred microliters of broth is added to 900 μl of sterile H2O, placed in a heating block at 100°C for 15 min, and centrifuged at 18,000 × g for 5 min. Upon transfer to a clean tube, the supernatant is used directly for PCR and stored at −18°C for further analyses. For PCR, a total volume of 20 μl contains 2.5 μl H2O, 10 μl HotStarTaq Master Mix Kit (Qiagen), 1.25 μl of each of two primers (stock solution of primers is 5 μM) and 5 μl supernatant of boiled lysate (stock). The thermocycler conditions are 95°C for 15 min followed by 35 cycles of 94°C for 50 s, 56°C for sequencing and detection, and 64°C for subtyping for 40 s and 72°C for 60 s, ending with 72°C for 3 min. PCR amplicons are stored at 4°C. The final resolution of stx2a, stx2c, and stx2d may require calibration of individual brands of thermocyclers by testing annealing temperatures from 64°C to 66°C on the test panel of reference strains. In our hands, an additional PCR using the stx2d primers was run at an annealing temperature of 66°C. False-positive stx2c fragments disappeared and true stx2d-positive fragments persisted at this annealing temperature. A total volume (20 μl) for standard PCR contains 2.5 μl H2O [if three primers are used (stx2a), the H2O volume is reduced to 1.25 μl; if four primers are used (stx2d or detection of all stx2 variants), H2O is not added]; 10 μl Mastermix (HotStarTaq, Qiagen); 1.25 μl of each of two primers (stock solution of primers is 5 μM) [if three primers are used (stx2a), the H2O volume is reduced to 1.25 μl; if four primers are used (stx2d or detection of all stx2 variants), H2O is not added]; and 5 μl supernatant of boiled lysate (stock).
Wobble bases are shown in bold.
For triplex PCR for subtyping of stx1, a total volume of 25 μl contains 12 μl Mastermix (HotStarTaq, Qiagen), 1 μl of each of the four primers for stx1c and stx1d (stock solution of primers is 5 μM), 2 μl of each of two primers for stx1a (stock solution of primers is 5 μM), and 5 μl supernatant of boiled lysate (stock).
All three reverse primers in the same reaction will result in amplicons of 179 bp with nine stx2d variants, 235 bp with variant stx2d-O55-5905, 280 bp with five stx2d variants, and finally two amplicons of 179 bp and 280 bp with variant stx2d-O73-C165-02.