Strains |
|
|
Streptomyces sp. K30 |
Wild type producing clear zones on NR latex overlay agar plates |
Rose et al. 2005 |
Streptomyces sp. K30_ lcp ΩKm |
lcp knock out mutant, clear zone negative |
This study |
Streptomyces lividans TK23 |
Clear zone negative; host strain for heterologous expression |
Hopwood 1983 |
Streptomyces lividans TK23 pIJ6021:: lcp
|
Producing clear zones on natural latex overlay agar plates; host strain for heterologous expression harboring wild-type lcp from Streptomyces sp. strain K30 |
This study |
Streptomyces lividans TK24 |
Clear zone negative; host strain for heterologous expression |
Hopwood 1986 |
Streptomyces lividans TK24 pIJ6021:: lcp
|
Producing clear zones on natural latex overlay agar plates; host strain for heterologous expression harboring wild-type lcp from Streptomyces sp. strain K30 |
This study |
Saccharopolyspora erythraea |
Wild type, clear zone negative; host strain for heterologous expression |
DSMZ 40517 |
Saccharopolyspora erythraea pIJ6021:: lcp
|
Producing clear zones on natural latex overlay agar plates; host strain for heterologous expression harboring wild-type lcp from Streptomyces sp. strain K30 |
This study |
Pseudomonas putida |
Wild type, clear zone negative; host strain for heterologous expression |
DSMZ 291 |
Pseudomonas putida KT2440 |
Clear zone negative; host strain for heterologous expression; pWW0-, r-, m+; spontaneous mutant from P. putida mt-2 |
Bagdasarian et al. 1982 |
Pseudomonas putida KT2440 pBBR1MCS2::Lcp_His6 |
Producing clear zones on natural latex overlay agar plates; host strain for heterologous expression harboring wild-type His - tagged lcp protein from Streptomyces sp. strain K30 |
This study |
Pseudomonas putida KT2440 pJB653::Lcp_His6 |
Producing clear zones on natural latex overlay agar plates; host strain for heterologous expression harboring wild type His - tagged lcp protein from Streptomyces sp. strain K30 |
This study |
Pseudomonas putida KT2440StrR
|
Clear zone negative; host strain for heterologous expression; pWW0-, r-, m+; spontaneous streptomycin resistant mutant from P. putida mt-2 |
Bagdasarian et al. 1981 |
Pseudomonas putida KT2440StrR pBBR1MCS2::Lcp_His6 |
Producing clear zones on natural latex overlay agar plates; host strain for heterologous expression harboring wild-type His - tagged lcp protein from Streptomyces sp. strain K30 |
This study |
Pseudomonas putida KT2440StrR pJB653::Lcp_His6 |
Producing clear zones on natural latex overlay agar plates; host strain for heterologous expression harboring wild-type His - tagged lcp protein from Streptomyces sp. strain K30 |
This study |
Escherichia coli Top10 |
Donor strain |
Stratagene |
Escherichia coli ET12567 |
Nonmethylating plasmid donor strain |
Flett and MacNeil 1992 |
Plasmids |
|
|
pET23a:: lcp _1 |
pET23a harboring the wild-type lcp from Streptomyces sp. strain K30 |
This study |
pBBR1MCS2 |
Broad host-range promoter-probe vector, pBBR1MCS2 |
Kovach et al. 1995 |
pBBR1MCS2::Lcp_His6 |
Shuttle vector harboring the wild-type His-tagged lcp protein from Streptomyces sp. strain K30 |
This study |
pJB653 |
Broad host-range promoter-probe vector, pJB653 |
Blatny et al. 1997 |
pJB653::Lcp_His6 |
Shuttle vector harboring the wild-type His-tagged lcp protein from Streptomyces sp. strain K30 |
This study |
pGEM-T Easy |
E. coli TA cloning vector; Apr
|
Promega |
pIJ6021 |
High-copy-number plasmid expression vector; contains a thiostrepton-inducible promoter, PtipA, from Streptomyces lividans 66 |
Takano et al. 1995 |
pIJ6021:: lcp
|
pIJ6021 harboring wild-type lcp from Streptomyces sp. strain K30 |
This study |
pIJ702 |
Plasmid contains the tyrosinase gene and thiostrepton resistance (tsr) gene |
Rose et al. 2005 |
pIJ702:: lcp _1 |
pIJ702 harboring wild-type gene and the native promoter region of lcp isolated from Streptomyces sp. strain K30 |
This study |
pIJ702:: lcp
|
pIJ702 harboring the wild-type lcp from Streptomyces sp. strain K30 |
Rose et al. 2005 |
Oligonucleotides |
|
|
PSPNter |
CCGAGATCTCGGCAGGACGAACTCCCCG |
Rose et al. 2005 |
PSPCter |
CCGAGATCTGGTGCGTCGAGG |
Rose et al. 2005 |
Hya_FW_XbaI |
AATCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAACAACGAAGAAACCTTTTATCAGGCC |
This study |
Hya_RW_NcoI |
AACCATGGGCGCCCACGCAATTTTCGGC |
This study |
pqspBBR-for:_Sal |
ATATGTCGACCTAAAATGGAGTCATGAACAACGAAGAAAACCTTTTATCAGGCCATG |
This study |
pqspBBR-rev:_Sac |
ATATGAGCTCCACCACCATCACCACCATGCTCGGACGGTTCACATCCGGAATATCAATCG |
This study |
pqspJB-for:_Sbf |
ATATCCTGCAGGTAAGGAGTCATGAACAACGAAGAAACCTTTTATCAGGCCATG |
This study |
pqspJB-rev:_Sac |
TATAGAGCTCCACCACCATCACCACCATGCTCGGACGGTTCACATCCGGAATATCAATCG |
This study |
Lcp_EcoRI_6021 |
AAAGAATTCTCAGGACGGGCGGTTGACGTCCGGGGATG |
This study |
Lcp_NdeI_6021 |
AAAAAAACATATGGCGATCCGCCTTCCGCCCGGCGCCCCGCG |
This study |
N_Lcp |
GGATCCTTACGTCAGTAGGCGTGGTCCAGGCCGTCGGTCGG |
This study |
C_Lcp |
GGATCCCGACCGGGATGACGTGCGGCAGTGGGCCC |
This study |