Table 1.
List of published HIV-1 microRNAs and their target HIV-1 and cellular gene products.
| HIV-1 microRNA Name (A) | Mature sequence variants (B) | Gene product (mRNA) targets (C) | Function of mRNA targets (D) | References |
|---|---|---|---|---|
| hiv1-miR-TAR-5p | 4-UCUCUCUGGUUAGACCAGAUCUGA-27 (Ra) | LTR d | Viral gene expression | Klase et al., 2007, 2009; Ouellet et al., 2008; Schopman et al., 2012 |
| UGGGUCUCUGGUUAGACCAG (Bp) | TAR d | Regulation/anti-apoptosis | ||
| GGUCUCUGGUUAGACCA (Nb) | RITS d | Viral co-factor | ||
| GGGUCUCUCUGGUUAGACCA (Nb) | ERCC1(apo) d | Cell apoptotic factor | ||
| IER3 (apo) d | Cell apoptotic factor | |||
| CUCUGGCUAACUACUAGGGAACCC (Ns) | ||||
| UCUGGCUAACUACUAGGGAA (Ns) | ||||
| UCUGGCUAACUACUAGGGAACCCA (Ns) | ||||
| CUGGCUAACUACUAGGGAA (Ns) | ||||
| UGGCUAACUACUAGGGAA (Ns) | ||||
| UGGCUAACUACUAGGGAACCCAC (Ns) | ||||
| UGGCUAACUACUAGGGAACCCACU (Ns) | ||||
| UGGCUAACUACUAGGGAACCCACUG (Ns) | ||||
| GGCUAACUACUAGGGAACCCACUG (Ns) | ||||
| CUAACUACUAGGGAACCCACUGC (Ns) | ||||
| hiv1-miR-TAR-3p | 38-UCUCUGGCUAACUAGGGAACCCA-60 (Ra) | TAR d | Viral gene expression | Klase et al., 2007; Schopman et al., 2012 |
| CUAACUAGGGAACCCAC (Nb) | RITS d | Regulation/anti-apoptosis | ||
| GCUAACUAGGGAACCCAC (Nb) | ||||
| GCUAACUAGGGAACCCACUG (Nb) | ||||
| hiv1-miR-H1 | 2-CCAGGG-AGGCGUGCCUGGGC-21 (Nb) | AATF d | Adaptive immunity | Kaul et al., 2009; Lamers et al., 2010 |
| CCAGGG-AGGCGUGgCaUGGGC (Mc) | BCL2 d | Activated cell | ||
| CCAGGG-AGGCGUGgCCUGGGC (Mc) | MYC d | Proliferation regulator | ||
| CCAGGG-AGGCGUGgCCUGGGC (Mc) | PAWR d; DICER d | Pro-viral latency promoter | ||
| CCAuGGgAGGCGcGgCCUGGGC (Mc) | ||||
| CCAGGG-AGGCGUGgCCgGGGu (Mc) | hsa-miR-194 d | MicroRNA processing | ||
| CCAGGGgAGGCGUGaCCUGGGC (Mc) | Pre-microRNA | |||
| Processing/microRNA binding | ||||
| hiv1-miR-N367 | 40-ACUGACCUUUGGAUGGUGCUUCAA-62 (Nb, Mc) | Nef d | Transcription factor and regulator | Omoto and Fujii, 2005 |
Notes: (A) The official names of microRNAs as published in mirbase.org. (B) The sequences of mature HIV-1 microRNA variants as determined by several methods including: Bp, bioinformatic prediction; Ra, RNase protection assays; Nb, Northern blotting; Ns, next generation sequencing; Mc, molecular cloning. Please note that sequences are not aligned accordingly; lowercase letters indicate polymorphic sites when available. The numbers before and after the nucleotide sequences refer to the relative genomic position/s in the pre-microRNA sequences if made available by authors in literature. (C) The mRNA targets of the HIV-1 microRNAs immediately followed by italicized letters correspond to the type of regulation, where: u = up-regulation, d = down-regulation when described in literature. In addition, if targets are HIV-1 mRNA genes or mRNA transcripts they are typed in boldface, RNAi pathway-related gene products typed in BLUE; and literature-based standard HIV-1 linked cellular gene products are typed in RED. (D) The reported functional attributes of mRNA targets by HIV-1 microRNA among studies.