| Gene | Forward primer | Reverse primer |
| Tnfα | Aaccctctgcccccgcgatg | tcctcgctgagggagcttctgc |
| p19 | Tagccacaacaacctcacca | aagcggcttcctgatttctt |
| Bpil2 | Attgagtaattgtagtgaggcaattatg | cctcaagcccaggatgagtc |
| Fpr1 | Ggatatactctcagggtccttg | tgaactttccaacagctctgg |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.