Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Agarose gel electrophoresis of 20-mer DNA (5’ CCACAGTGTTTGTGCAGCGG 3’) at increasing +/- ratios of G5-NH2-PEG. Free DNA is indicated by the band marked with the arrow. Loss of migration of DNA in the lane indicates complexation with dendrimer.
