Skip to main content
. 2012 Sep 12;7(9):e44210. doi: 10.1371/journal.pone.0044210

Table 2. Known or predicted direct targets of AphA.

Gene name Gene ID AphA box-like sequence Position& Score Reference Regulation by AphA
V. parahaemolyticus RIMD 2210633
aphA VP2762 GTATTCCACTTCATGCTTAT D-238…-219 16.37 This study Negative
opaR VP2516 ATATGCACCATTACACTCAT D-98…-79 18.32 This study Negative
qrr4 VPA0199-0200 intergenic ATATGCCACTTGTTACATTG R-146…-127 10.96 This study Negative
Vibrio sp. Ex25
aphA VEA_002309 CTATTCCACTTCATGCTTAT D-240…-221 15.71 Predicted Negative
luxR VEA_002553 ATATGCACCATTACACTCAT D-161…-142 18.32 Predicted Negative
qrr4 VEA000800-000799 intergenic ATATGCCACTTCATGCACTG R-146…-127 14.05 Predicted Negative
Vibrio sp. EJY3
aphA VEJY3_14120 GTATTCCACTTCATGCTTAT D-242…-223 16.37 Predicted Negative
luxR VEJY3_12990 ATATGCACCATTACACTCAT D-98…-79 18.32 Predicted Negative
qrr4 VEJY316416-16421 intergenic ATATGCTACCAACCGCATTG R-145…-126 7.64 Predicted Negative
V. harveyi ATCC BAA-1116
aphA VIBHAR_00046 CTATTCCACTTCATGCTTAT D-240…-221 15.71 [7] Negative
luxR VIBHAR_03459 ATATGCACCATTACACTCAT D-101…-82 18.32 [7] Negative
qrr4 VIBHAR_06697 ATATGCCACCATGCGCATTG R-146…-127 11.01 [7] Negative
V. vulnificus YJ016
aphA VV3005 CTATTCCACTTTATGCTTAT D-238…-219 16.45 Predicted Negative
smcR VV2770 ATATGCACCATTACACTCAT D-110…-91 18.32 Predicted Negative
qrr4 VVA0457-0458 intergenic ATACACACAAATTTGCATAT R-97…-78 8.65 Predicted Negative
V. splendidus LGP32
aphA VS_2891 GTATTCTACTTTATGCTTAT D-237…-218 15.94 Predicted Negative
luxR VS_2539 ATATGCACCATTACACTCAT D-79…-60 18.32 Predicted Negative
V. anguillarum 775
aphA VAA_02615 GTATTCTACTTTATGCTTAT D-253…-234 15.94 Predicted Negative
vanT VAA_00743 ATATGCAGCAGTACACTCAT D-99…-80 13.81 Predicted Negative
V. cholerae N16961
aphA VC2647 GTATTCCACTTTATGCTTAT D-245…-226 17.11 [30] Negative
hapR VC0583 ATATGCACCATTACACTCAT D-101…-82 18.32 Predicted Negative
pva VCA0877 ATATGCAACAAATTACACAT D-178…-159 12.75 [44] Negative
alsR VC1588 ATATACACACAGATTCATAT R-93…-74 8.6 [29] Negative
alsD VC1589 ATATACACACAGATTCATAT D-32…-13 8.6 [29] Negative
vpsT VCA0952 ATACGCAAAAAGACTCTTAT R-242…-223 10.7 [28] Positive
tcpP VC0826 TTATGCAATTAAGTTCTCAT D-110…-91 6.71 [27]
V. furnissii NCTC 11218
aphA vfu_A00617 GTATTCTACTTTATGCTTAT D-246…-227 15.94 Predicted Negative
luxR vfu_A00883 ATGTACGCAATTACACTCAT D-104…-85 9.66 Predicted Negative

&, ‘D’ indicates the direct sequence, and the minus numbers denote nucleotide positions upstream of genes.