Figure 2. Stimulation of TLR7 mRNA expression on B cells by NK cells.

Resting B cells from B6 (A) or IFNAR^0/0 (B) mice were cultured for 24 h in the presence of various reagents as indicated, with or without IL-2-propagated NK cells before TLR7 ligand (5 μg/ml) was added for another 20 h (ratio of NK:B=0.5). RNA prepared from each culture was then processed for semiquantitative RT-PCR analysis. Level of expression of each product was normalized to the level of invariant chain (Ii) of MHC II within each sample. ImageJ, a public domain, Java-based image processing program, developed at the U.S. National Institutes of Health, was used for semiquantitative determination of relative expression from gel bands. Mean (±sem) for each culture condition was derived from eight similar experiments for WT B cells and four for IFNAR^0/0 B cells. (C) B cells from TLR7^0/0 or B6 mice were stimulated with NK cells and assayed as in A and B. Results shown are representative of two independent experiments. Sequence of primers: TLR7, forward 5′TGGCCAGAGAAATTGAGGAGGCCA, reverse 5′CCGCAACTCTCTCAACGGCCA; IL-6, forward 5′CCGGAGAGGAGACTTCACAG, reverse 5′GGAAATTGGGGTAGGAAGGA; invariant chain, forward 5′GAGGCTAGAGCCATGGATGAC, reverse 5′AGATGCTCCAGATTCTCTGGG.