Skip to main content
. 2012 Oct;92(4):713–722. doi: 10.1189/jlb.0212064

Figure 5. Role of IL-28 in the NK cell-mediated enhancement of B cell TLR7 mRNA.

Figure 5.

(A) Histograms from FACS analysis of purified, resting B cells stained with GαIL-28αR (Abcam, Cambridge, MA, USA), followed by FL-donkey anti-goat Ig before (shaded, dark) and after overnight culture with NK cells (dark line) or with IL-28 plus TLR7 ligand (L; dotted line). Light line represents cells stained without primary antibody. (B and C) RT-PCR analysis of RNA prepared from overnight cultures of B cells after stimulation with IL-28 (2 μg/ml) or with NK cells, with or without TLR7 ligand under conditions as indicated and using primers as noted. Rows separated by vertical lines are images taken from a different segment of the same gel. Similar results were obtained from at least two additional experiments. Representative experiment of the relative TLR7 mRNA expressed in cells cultured for 20 h, alone or with IL-2-propagated NK cells in the presence of anti-IL-28 or control antibody (rat Ig). (E) Average inhibition of NK cell-mediated enhancement of TLR7 mRNA by anti-IL-28, calculated from the results of four to five experiments using freshly isolated or IL-2-propagated NK cells. Percent inhibition = (relative mRNA in NKB cocultures−relative mRNA in the presence of inhibitor/relative mRNA without inhibitor)100. P ≤ 0.028 for the possibility that the two sets of data are identical. (F) Relative TLR7 mRNA expression in cocultures containing additives, as indicated from two independent experiments, and relative IL-6 mRNA in the presence of ligand. (G) Relative TLR7 mRNA in cultures of B cells placed in direct contact with NK cells (cis) or separated by a semipermeable membrane (trans) and relative IL-6 mRNA in cultures containing TLR7 ligand. Sequence of primers: IL-28a, forward 5′GCAGCTGCAGGTCCAAGAGCG, reverse 5′ TCCCGGGTGAGCAGGCGAA; IL-28R, forward 5′GAAGGCCCCGTCTAGCCCCA, reverse 5′TCCAGCGACGGCATGCAAGG; Ly49, forward 5′ATCATCCCAAGATGAGTGAGC, reverse 5′TTAGATGGGCCATTGTCAATC.