Figure 1 .
Ex1: Starting from open chain (left), six stages during the folding. SSA version I, sequence ‘GAGCAUCCGUGUAACCAUUCACACUGCUC ' is used.
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.