Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2012 Jul 19;40(18):9340–9355. doi: 10.1093/nar/gks677

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© The Author(s) 2012. Published by Oxford University Press.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

PMC Copyright notice

Figure 6. — Direct binding of Rv3066 to the mmr-rv3066 promoter by dye primer based DNase I footprint assay. Electropherograms indicating the protection pattern of the mmr-rv3066 promoter after digestion with DNase I following incubation with (a) 0, (b) 1.5 and (c) 3.0 pmol of dimeric Rv3066 are shown. The protected DNA sequence TTGTGTACATTTGTACACAAAGG containing IR1 is also shown.