Table 1.
Putative CBNAC-binding cis-acting elements in the PR1 promoter
| cis element | Sequencea | Positionb | Binding affinityc |
|---|---|---|---|
| E0-1-1 | TAATAATGCTTAGTTATAAATTACT | (–) 1209 ∼ (–) 1185 | +++ |
| E0-4-2 | TGTTATTGCTTAGAATCACAGATTC | (–) 994 ∼ (–) 970 | ++ |
| E3-1-2 | CTATTGACTGTTTCTCTACGTCACTATT | (–) 715 ∼ (–) 688 | ++ |
| E4-1-1 | ATACTCATATGCATGAAACACTAAGAAAC | (–) 618 ∼ (–) 590 | + |
| E5-3-1 | ATATACAATGTTTCTTAATAAACTTCATTT | (–) 340 ∼ (–) 311 | ++ |
| E6-1-1 | AAAAAAATATATCAACAATGGCAAAGCT | (–) 288 ∼ (–) 261 | + |
aSequences are indicated from 5′ to 3′. GCTT core sequence is underlined.
bPositions of the cis elements with respect to the translation start site (ATG).
cThe relative binding affinity (+) was determined by densitometry of autoradiograms of DNA-bound CBNAC.