Fig. 3.
Inhibition of CK1δ/ε prevents interaction of Per1 with E-box3 in the Scnn1a promoter. mpkCCDc14 cells were treated with the CK1δ/ε Inh PF670462 for 72 h. Nuclear extracts from treated and control cells were incubated with biotinylated probes containing the sequence 5′ tggtgggggccagcaggtgcttcccagttt, which represents E-box3 from the Scnn1a promoter (see Ref. 19). Western blot analysis was performed using anti-Per1 and anti-Clock antibodies. A nonspecific band at 25 kDa was used as a loading control from the Ponceau S-stained Western blot. Data are representative of 3 independent experiments.