Table 2. Novel and known murine endo-siRNAs represented in 9 sequencing datasets including MHV68-infected (MHV68), mock-treated murine cells (mock; GSE36639); mouse embryonic stem cell (mESC; GSE12521); newborn embryo (nb), 7.5-, 9.5-, and 12.5- day point embryo cells (e7p5 etc.), testes (GSE20384) and oocyte (GSE10364).
| ID | sequence | MHV68 | mock | mESC | nb | e7p5 | e9p5 | e12p5 | testes | oocyte |
| siRNA3a | UUGUGUCAUCAUGCCUGACUUU | 4 | 0 | 43 | 0 | 7 | 0 | 0 | 0 | 0 |
| siRNA1.1b | AAGCCGGGCCGUAGUGGCGCA | 14 | 4 | 2051 | 0 | 78 | 8 | 43 | 25 | 0 |
| siRNA1.2b | AGCCUUUAAUUUCAGUACUUGG | 26 | 9 | 14105 | 52 | 7 | 267 | 8 | 25 | 0 |
| siRNA2.1b | CCUUUAAUCUCGACACUUGGA | 5 | 0 | 175 | 0 | 70 | 142 | 43 | 1574 | 21 |
Read counts were normalized across the samples.
a
newly identified siRNA.
b
siRNAs annotated in the previous study [12].