Table 2.
Primers for quantitative RT-PCR.
| Gene1 | Accession no.1 | Description | SABiosciences Cat. no.2 |
|---|---|---|---|
| IL-1B | NM_000576 | Interleukin 1, beta | PPH00171B |
| IFNG | NM_000619 | Interferon, gamma | PPH00380B |
| IL-12A | NM_000882 | Interleukin 12A | PPH00544B |
| IL-6 | NM_000600 | Interleukin 6 | PPH00560B |
| TNF-alpha | NM_000594 | Tumor necrosis factor (TNF superfamily, member 2) | PPH00341E |
| IL-10 | NM_000572 | Interleukin 10 | PPH00572B |
| IL-2 | NM_000586 | Interleukin 2 | PPH00172B |
| TGFB2 | NM_003238 | Transforming growth factor, beta 2 | PPH00524B |
| IL-5 | NM_000879 | Interleukin 5 | PPH00692A |
| TNFSF10 | NM_003810 | Tumor necrosis factor (ligand) superfamily, member 10 | PPH00242E |
| GAPDH | NM_002046 | Glyceraldehyde-3-phosphate dehydrogenase | PPH00150E |
| ACTB | NM_001101 | Actin, beta | PPH00073E |
| TBX21 | NM_013351 | T-box-21 (T-bet) | PPH00396A |
| GATA3 | NM_002051 | GATA-binding protein 3 | PPH02143A |
| FOXP3 | NM_014009 | Forkhead box P3 | PPH00029B |
| STAT4 | NM_003151 | Signal transducer and activator of transcription 4 | PPH00777E |
| RORC | NM_005060 | RAR-related orphan receptor C | PPH05877A |
| MAPK1 | NM_002745 | Mitogen-activated-protein-kinase 1 | PPH00715B |
| AKT1 | NM_005163 | v-akt murine-thymoma viral-oncogene-homolog 1 | PPH00088A |
| CD38 | NM_001775 | CD38 molecule | PPH00856A |
| ZAP70 | NM_001079 | Zeta-chain (TCR) associated protein kinase 70 kDa | PPH00256A |
| CD247 | NM_000734 | CD247 molecule, CD3-zeta. | PPH01484A |
| CCR6 | NM_004367 | Chemokine (C-C motif) receptor 6 | PPH00616E |
|
| |||
| Gene1,3 | Forward primer (5′–3′)4 | Reverse Primer (5′–3′)4 | Ref. |
|
| |||
| GAPDH (NM_002046) | gaaggtgaaggtcggagtc | gaagatggtgatgggatttc | Primer3 software3 |
2SABiosciences, QIAGEN company.
4Primers used for this study based on the literature were computationally checked for sequence specificity. Melt-curve analysis for each primer pair and reaction was also tested to verified specific amplification.