Table 1. Primers for PCR amplification and sequencing, primer binding sites, primer pairings, and amplified fragment sizes and sites.
Primer | Binding Sitea | |
---|---|---|
F1: 5′CAAAGCACATCTTGCCAGGA3′ | c.–212 to c.–193 (5′ insertion site of NANOGP8) | |
F2: 5′GGCCGAAGAATAGCAATGGTGTGACG3′ | c.473 to c.498 (exon 3 in NANOG and NANOGP8) | |
F3: 5′CTCCAGTCACAGACAGTTCTGGTTGTCC3′ | c.502–64C to c.502–37C (intron 3 in NANOG) | |
F4: 5′GAATAGCAATGGTGTGACGCAGAAGG3′ | c.477 to c.496 (splice site for exons 3 and 4 in NANOGP8) | |
F5: 5′GGACAGCCCTGATTCTTCCACCAG3′ | c.189 to c.212 (second exon in NANOGP8, internal primer for sequencing cloned DNA) | |
R1: 5′GGTTATTAAAATGTCTTTTCTAGGCAGGGCGC3′ | c.*512 to c.*543 (3′ boundary of Alu element in 3′ UTR of NANOG and NANOGP8) | |
R2: 5′CTTATCTATAGCCAGAGACGGCAGCC3′ | c.*546 to c.*551 and c.*574 to c.*593 (22 nucleotide-pair deletion in 3′ UTR of NANOG and NANOGP8) | |
R3: 5′GCTTCTATCAATGTTGTCCTTAGC3′ | c.*550 to c.*573 (ancestral, non-deletion site in NANOG 3′ UTR) | |
R4: 5′CCATACTCCACCCTCCATGAG3′ | c.*140 to c.*160 (3′ UTR in NANOGP8, internal primer for sequencing cloned DNA) | |
Primer Pair | Fragment Size | Fragment Sitea |
F1/R1 | 1681 | c.–212 to c.*543 from NANOGP8 |
F2/R1 | 1132 | c.473 to c.*543 from NANOG |
997 | c.473 to c.*543 from NANOGP8 | |
F2/R2 | 1157 | c.473 to c.*593 from NANOG deletion allele |
1025 | c.473 to c.*593 from NANOGP8 | |
F2/R3 | 1154 | c.473 to c.*573 from NANOG allele without deletion |
F3/R1 | 1029 | c.502–64C to c.*543 from NANOG |
F4/R1 | 990 | c.477 to c.*543 from NANOGP8 |
Nucleotides are numbered in accordance with Nomenclature for the Description of Sequence Variants of the Human Genome Variation Society (http://www.hgvs.org/mutnomen), as follows: The symbol “c.” refers to coding sequence. Numbering in the reading frame begins at the first nucleotide of the initiation codon and ends with the final nucleotide of the termination codon. Nucleotides in the 5′ UTR are numbered in reverse, denoted with a negative sign (–), with the nucleotide preceding the first nucleotide of the reading frame designated as –1. Nucleotides in the 3′ UTR are numbered consecutively, denoted with an asterisk (*), with the first nucleotide beyond the final nucleotide of the reading frame designated as *1.