Table 1.
Frequency on KIR3DL1 and KIR3DS1 allelesa in unrelated African American individuals (n=100)
| KIR3DL1 | No. of individuals (= % of individuals) |
KIR3DL1 | No. of individuals (= % of individuals) |
KIR3DS1 | No. of individuals (= % of individuals) |
|---|---|---|---|---|---|
| 3DL1*00101 | 17 | 3DL1*022 | 6 | 3DS1*01301 | 17 |
| 3DL1*002 | 3 | 3DL1*023 | 1 | 3DS1*049N | 2 |
| 3DL1*00401 | 14 | 3DL1*025 | 2 | 3DS1*058 | 0 |
| 3DL1*00402 | 3 | 3DL1*028 | 1 | Absent | 82 |
| 3DL1*00501 | 11 | 3DL1*029 | 1 | ||
| 3DL1*007 | 8 | 3DL1*031 | 10 | ||
| 3DL1*008 | 3 | 3DL1*033 | 2 | ||
| 3DL1*01501 | 29 | 3DL1*039 | 1 | ||
| 3DL1*01502 | 23 | 3DL1*041 | 2 | ||
| 3DL1*016 | 1 | 3DL1*059 | 3 | ||
| 3DL1*01701 | 10 | New allelesb | 9 | ||
| 3DL1*019 | 2 | Absent | 1 | ||
| 3DL1*020 | 5 |
Genomic DNA was isolated from 100 unique and unrelated African Americans from the human variation panel obtained from the National Institute of General Medical Sciences (NIGMS) Human Genetics Resource Center DNA and Cell Line Repository (http://ccr.coriell.org/nigms/) using a QIAamp® DNA Blood Mini Kit (Qiagen, Valencia, CA). Sequence specific priming followed by gel electrophoresis was used to test for the presence or absence of KIR3DL1 and KIR3DS1 using polymerase chain reaction (PCR) primers previously described (13). Five sets of PCR primers were used to generate overlapping amplicons containing all alleles of the KIR3DL1 locus except the KIR3DL1/KIR3DL2 alleles (KIR3DL1*059,*060,*061). DNA were amplified as previously reported (14) with the following exceptions. Exons 8 and 9 were amplified using primers described by Sun et al. (15). An amplicon including exon 4 through exon 9 of the KIR3DL1/KIR3DL2 alleles was amplified by primers 3DL1 SSPF (16) and 3DL2 Exon9R (GGCTGTTGTCTCCCTAGAAA)(17). Together the KIR3DL1 amplicons included exon 1 through the 3’untranslated region (UTR) covering a region of approximately 14,700 base pairs. Two primers pairs were used to amplify KIR3DS1 including exon 1 to the 3’UTR as previously described (14). For some amplicons, the Roche Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) was used to improve PCR product yield and amplicon fidelity according to the manufacturer’s protocol. Amplifications were carried out in a 2720 model thermal cycler (Applied Biosystems, Foster City, CA). The initial DNA denaturation was performed with one cycle of 92°C for two minutes. The PCR amplification included 10 cycles of 92°C for 10 sec; 60°C for 30 sec; 68°C for 11 min followed by 45 cycles of 92°C for 15 sec; 57°C for 30 sec; 68°C for 11 min (increasing the 11 min extension time by 20 sec each cycle). A final extension was carried out for 7 min at 68°C. DNA sequencing used primers and methods already described (14) with the addition of three KIR3DL1 primers TGGAGCACCCTAGTCTCACC (annealing in intron 2, antisense) ATTCAGGAGGTGGGACAGTG (intron 3, antisense), and ACCCTCACTCATTCCAGGTG (intron 4, sense). Sequences were compared to the IPD-KIR version 2.1.0 database (February 2009) to determine allelic assignments.
This includes seven novel alleles, five identified in single individuals and two identified in two individuals each. Novel alleles were isolated using allele specific amplification, cloning (TOPO-XL, Invitrogen, Carlsbad, CA) and/or by using haplotype specific extraction (3DL1-199G, 3DL1-208A,3DL1-229T; HaploPrep, Qiagen, Valencia, CA). KIR allele designations for novel alleles were assigned by the WHO Nomenclature Committee for Factors of the HLA System (18).