Table 3.
Sequence alignment of genomic regions containing polymorphisms that differentiate M. ulcerans strains from northern Australia
| Locus | Origina | Sequence (5′–3′)b | Sequence changec |
|---|---|---|---|
| 9d | QLD | GTGGCGATCGTAAGCTCGGCGCAGCCGGGGTTGCCA | G insertion after nucleotide 2814032 |
| NT/WA | ..........................-......... | ||
| 19e | QLD | GGTACGGTGCACGGTGTGAAGTCGCTCCCGTGCCCA | C/T substitution at nucleotide 4981684 |
| NT/WA | ............................T....... |
a
QLD, Queensland; NT/WA, Northern Territory/Western Australia.
b
., identical nucleotide position; -, base deletion.
c
Nucleotide position relative to M. ulcerans Agy99 complete genome (GenBank accession no. CP000325.1).
d
Sequence shown represents the third repeat unit in the region amplified by the VNTR locus 9 primers described by Ablordey et al. (2).
e
Sequence shown begins 50 bp downstream of the second repeat unit in the region amplified by the VNTR 19 primers described by Ablordey et al. (2).