Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this work
| Primer | 5′–3′ sequence (underlined restriction site) | Position |
|---|---|---|
| X1 | TTTTGTCTGAATTCCAAAACTCTT (EcoRI) | 5′ llmg2447 promoter |
| X2 | CCGGATCCATTTCCTCCCCTCTC (BamHI) | 3′ llmg2447 promoter |
| X3 | TGTTCGATACATAAAAGCCCG | 3′ llmg2447 promoter |
| X4 | ATCTGCAGTGGCTCCTCTAATC (PstI) | 5′ llmg2447 gene |
| X5 | GCAAAGAATTCAATGACCGCCT (EcoRI) | 3′ llmg2447 gene |
| X6 | ACGAATTCATCAAAGTTTAGGGTATC (EcoRI) | 5′ IS981::2447 promoter |
