Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
PCR primers and probe for the amoA gene
| Name | Sequence (5′-3′) | Positiona | Concn (nM) | Reference |
|---|---|---|---|---|
| Primer A189 | GGHGACTGGGAYTTCTGG | 151-168 | 300 | 19 |
| Primer amoA-2R′ | CCTCKGSAAAGCCTTCTTC | 802-820 | 900 | This study |
| Probe A337 | TTCTACTGGTGGTCRCACTACCCCATCAACT | 337-367 | 100 | This study |
| Primer amoA-2R-TG | CCCCTCTGGAAAGCCTTCTTC | 800-820 | 400 | This study |
Position is based on the open reading frame of amoA of N. europaea.
