TABLE 1.
PCR primers and probe for the amoA gene
Name | Sequence (5′-3′) | Positiona | Concn (nM) | Reference |
---|---|---|---|---|
Primer A189 | GGHGACTGGGAYTTCTGG | 151-168 | 300 | 19 |
Primer amoA-2R′ | CCTCKGSAAAGCCTTCTTC | 802-820 | 900 | This study |
Probe A337 | TTCTACTGGTGGTCRCACTACCCCATCAACT | 337-367 | 100 | This study |
Primer amoA-2R-TG | CCCCTCTGGAAAGCCTTCTTC | 800-820 | 400 | This study |
Position is based on the open reading frame of amoA of N. europaea.