Figure 2. Agarose gel showing a RT-PCR band obtained with RNA isolated from Lactobacillus casei BL23 (wt) cultured on MRS fermentation medium with 0.5% glucose. Total RNA was used in RT reactions using the Maxima First strand cDNA Synthesis Kit (Fermentas) with Maxima Enzyme Mix (lane 2) or without Maxima Enzyme Mix (lane 3). The cDNAs obtained were used in PCRs with primers glmM4 (CACTGAACCTTTGTTGCGG) and glmS1 (ACTTCTCTAATCCCTTAAGC). Size standard markers are shown in lane 1. The size of the fragment obtained is marked on the right.