Table 1.

TLA1 gene primers used for cloning TLA1 inverted repeats and full-length gene in pSL72 and pSL18, respectively.

‘Primer A’ (TLA1 first exon-specific forward primer; 5′ GTTGATATCAGCGTGAATGGTGTCCTCGT 3′) and ‘primer B’ (TLA1 second exon-specific reverse 5′ GTTGAATTCCCTTGCTGCCATCCTTGCTG 3′); used for generation of the first TLA1 inverted repeat (no. 1; 367 bp, figure 2a) for RNAi cloning in pSL72 vector

‘Primer C’ (TLA1 second exon-specific forward 5′ GTTGGATCCCCTTGCTGCCATCCTTGCTG 3′) and ‘primer D’ (TLA1 first exon-specific reverse primer 5′ GTTTCTAGAAGCGTGAATGGTGTCCTCGT 3′); used for generation of the second TLA1 inverted repeat (no. 2; 367 bp, figure 2a) for RNAi cloning in pSL72 vector

‘Primer 8’ (5′ GGAATTCCATATGACTTTCAGCTGCTC3′) and ‘primer 9’ (5′ GCTCTAGACTTACAGCGCGTTGCC GGGCAAC 3′); used for cloning of full-length TLA1 gene (759 bp) in the pSL18 vector