Figure 3. Functional test of the expression of AnnX-like genes. (a) Outline of the strategy followed. 5′ RACE experiments were performed to detect the presence of the putative transcripts corresponding to the AnnX-like genes in whole body and testis of 5-d-old males. The experiments were done following the instructions of the kit from Epicenter ExactSTART Eukaryotic mRNA 5′-&3′-RACE. Primers used: outer primer (blue; 5′GGATCCAAGTAGGGCTGTCA3′), located on the third exon of AnnX and the second exon of AnnX-like (only CG33491 is shown); inner primer (red; 5′GACTGGACGCACTCAACTATGG3′), located at the junction of the second and third exons; and a 5′ primer from the kit used (purple). The sequences of the outer and inner primers are complementary to those of the two AnnX transcripts and to that putatively transcribed from the AnnX-like genes according to FlyBase.²⁵AnnX transcript specific primers (brown) were used for RT-PCR experiments with the only purpose to test for the quality of the cDNA and the presence of genomic DNA. (B) Results for the expression profiling experiments in testis. Left, 5′ RACE products amplified from cDNAs of total RNA from males carrying the wild-type configuration for the Sdic multigene family (B⁺). Lanes: 1) PCR product using AnnX specific primers; 2) PCR product using the outer primer and the 5′ primer; 3) PCR product using the inner primer and the 5′ primer; 4) H₂O, negative control (cDNA but no primers added); L) ladder. Right, summary table with the expected size of the PCR products for the two transcripts of AnnX and for the putative transcript of AnnX-like genes. Evidence for the presence of the two AnnX transcripts was detected but not for the putative transcript of AnnX-like genes. Experiments using total RNA from whole bodies as starting material shown identical results (not shown).