pVZS-F1 |
Cgcacagctccataggccg |
Forward primer near 3′ of self-replicating region |
pVZS-R1 |
gcgcttatggcagagcaggg |
Reverse primer near 5′ of self-replicating region |
pVZ_Nhe_F |
gctgcccggatGCTAGCtgaaagcgacc |
Forward primer to amplify self-replicating region |
pVZ_Eag_R |
gtgacaccacgCGGCCGgcaggagcaga |
Reverse primer to amplify self-replicating region |
pZS_Eag_F |
ggcttaccCGGCCGactgtccctagtgc |
Forward primer to amplify Sp/Str resistance cassette |
pTrc_Avr_Rev |
cagggttattgtCCTAGGagcggatac |
Reverse primer to amplify repressor and promoter region in pDF-trc-EFEh |
pTrc_Bsr_Fw |
ctgacgggctTGTACActcccggcatc |
Forward primer to amplify repressor and promoter region in pDF-trc-EFEh |
pSp1_Rev |
catcaaacatcgacccacggcg |
Forward primer to control insertions |
pZE13_Spe_F |
cagggttattgACTAGTgagcggatac |
Forward primer to clone Lac promoter from pZE13-MCS vector to prepare pDF-lac-EFEh |
pZE13_Kpn_R |
gggggcccGGTACCtttctcctct |
Reverse primer to clone Lac promoter from pZE13-MCS vector |
petE_Bsr_Fw |
cagtTGTACAagcggttgcccaatctaac |
Forward primer to clone petE promoter from 6803 genome |
petE_Eco_Rev |
catgGAATTCatacttcttggcgattg |
Reverse primer to clone petE promoter from 6803 genome |
coaR_Bsr_Fw |
cagtTGTACAgcacactaaagacaagtgag |
Forward primer to clone coaR repressor and promoter from 6803 genome |
coaR_Eco_R |
tctcGAATTCgctttttaacttggatttttacc |
Reverse primer to clone coaR repressor and promoter from 6803 genome |
smtA_Bsr_Fw |
atatTGTACAttagtgggtgtgtccatcctc |
Forward primer to clone smtA repressor and promoter from 7002 genome |
smtA_Eco_R |
gtgtGAATTCctattggtgacaagtacagccc |
Reverse primer to clone smtA repressor and promoter from 7002 genome |
pDF_Spe_Fw |
gcaacgcaattaatACTAGTtagcgcgaattgatc |
Generate SpeI site by site directed mutagenesis |
pDF_Spe_Rev |
gatcaattcgcgctaACTAGTattaattgcgttgc |
Generate SpeI site by site directed mutagenesis |