Table 3. Primers used in this work. Sequences recognized by restriction enzymes are designated in uppercase font. Bases that are not complementary are underlined and overhangs are shown in italic.

Primer	Sequence 5′ − 3′	Additional information
pVZS-F1	Cgcacagctccataggccg	Forward primer near 3′ of self-replicating region
pVZS-R1	gcgcttatggcagagcaggg	Reverse primer near 5′ of self-replicating region
pVZ_Nhe_F	gctgcccggatGCTAGCtgaaagcgacc	Forward primer to amplify self-replicating region
pVZ_Eag_R	gtgacaccacgCGGCCGgcaggagcaga	Reverse primer to amplify self-replicating region
pZS_Eag_F	ggcttaccCGGCCGactgtccctagtgc	Forward primer to amplify Sp/Str resistance cassette
pTrc_Avr_Rev	cagggttattgtCCTAGGagcggatac	Reverse primer to amplify repressor and promoter region in pDF-trc-EFEh
pTrc_Bsr_Fw	ctgacgggctTGTACActcccggcatc	Forward primer to amplify repressor and promoter region in pDF-trc-EFEh
pSp1_Rev	catcaaacatcgacccacggcg	Forward primer to control insertions
pZE13_Spe_F	cagggttattgACTAGTgagcggatac	Forward primer to clone Lac promoter from pZE13-MCS vector to prepare pDF-lac-EFEh
pZE13_Kpn_R	gggggcccGGTACCtttctcctct	Reverse primer to clone Lac promoter from pZE13-MCS vector
petE_Bsr_Fw	cagtTGTACAagcggttgcccaatctaac	Forward primer to clone petE promoter from 6803 genome
petE_Eco_Rev	catgGAATTCatacttcttggcgattg	Reverse primer to clone petE promoter from 6803 genome
coaR_Bsr_Fw	cagtTGTACAgcacactaaagacaagtgag	Forward primer to clone coaR repressor and promoter from 6803 genome
coaR_Eco_R	tctcGAATTCgctttttaacttggatttttacc	Reverse primer to clone coaR repressor and promoter from 6803 genome
smtA_Bsr_Fw	atatTGTACAttagtgggtgtgtccatcctc	Forward primer to clone smtA repressor and promoter from 7002 genome
smtA_Eco_R	gtgtGAATTCctattggtgacaagtacagccc	Reverse primer to clone smtA repressor and promoter from 7002 genome
pDF_Spe_Fw	gcaacgcaattaatACTAGTtagcgcgaattgatc	Generate SpeI site by site directed mutagenesis
pDF_Spe_Rev	gatcaattcgcgctaACTAGTattaattgcgttgc	Generate SpeI site by site directed mutagenesis