Abstract
Ceftriaxone, an FDA-approved third-generation cephalosporin antibiotic, has antimicrobial activity against both gram-positive and gram-negative organisms. Generally, ceftriaxone is used for a variety of infections such as community-acquired pneumonia, meningitis and gonorrhea. Its primary molecular targets are the penicillin-binding proteins. However, other activities of ceftriaxone remain unknown. Herein, we report for the first time that ceftriaxone has antitumor activity in vitro and in vivo. Kinase profiling results predicted that Aurora B might be a potential ‘off’ target of ceftriaxone. Pull-down assay data confirmed that ceftriaxone could bind with Aurora B in vitro and in A549 cells. Furthermore, ceftriaxone (500 µM) suppressed anchorage-independent cell growth by targeting Aurora B in A549, H520 and H1650 lung cancer cells. Importantly, in vivo xenograft animal model results showed that ceftriaxone effectively suppressed A549 and H520 lung tumor growth by inhibiting Aurora B. These data suggest the anticancer efficacy of ceftriaxone for the treatment of lung cancers through its inhibition of Aurora B.
Introduction
Drug development is a time-consuming and costly process, moving from preclinical screening through to clinical trials while resulting in only a few drugs being proven effective and thereby gaining approval. More than $800 million is the estimated cost with 10–17 years required for developing a drug de novo (1). Reverse side effects, usually caused by the drug’s interaction with secondary or ‘off’ targets, are the most common reasons for drug development termination, either in clinical trials or even after the drug has entered the market (2). Predicting ‘off’ targets for established drugs or harnessing them for novel drug development is referred to as drug repositioning (1). The supposition of drug repositioning is that these types of drugs are probablyto enter clinical trials more quickly and less expensively. Thus, interest in this strategy has been growing in importance in recent years.
Several pieces of convincing evidence suggest that identifying potential ‘off’ targets of known drugs not only will help to avoid severe side effects but also support the possibility of optimizing these for new uses (3). For example, acetophenazine, fluphenazine and periciazine, the phenothiazine derivatives, which were usually used as antipsychotic drugs in the clinic, were further identified as androgen receptor antagonists (4). Orlistat, an FDA-approved anti-obesity drug, was found to inhibit endothelial cell proliferation and angiogenesis by suppressing several new targets (5–8). As a result, this compound, as well as other orlistat-like analogues, has been proposed as a potential anticancer drug (9).
Ceftriaxone, an FDA-approved third-generation cephalosporin antibiotic, is used primarily to treat community-acquired or mild-to-moderate pneumonia (10) and is also a drug of choice for treatment of bacterial meningitis and gonorrhea (11,12). The bactericidal activity of ceftriaxone results from the inhibition of cell wall synthesis and is reportedly mediated through ceftriaxone’s binding to penicillin-binding proteins (13). Recently, Ceftiofur, a new broad-spectrum, third-generation cephalosporin antibiotic for veterinary use, was found to significantly inhibit phosphorylation of extracellular signal-regulated kinases (ERKs), p38 and c-jun NH2-terminal kinases (JNKs) in RAW264.7 mouse macrophage cells (14). The mitogen-activated protein kinase (MAPK) signaling pathway plays a key role in the regulation of gene expression, cellular growth and survival. However, abnormal MAPK signaling leads to uncontrolled cell proliferation and resistance to both apoptosis and chemotherapy (15,16). This suggested potential antitumor activities of Ceftiofur in cancer therapy. However, the potential anticancer activities of ceftriaxone, which has a structural formula similar to Ceftiofur, have not yet been fully explored.
In the current study, we found that ceftriaxone inhibited anchorage-independent growth of A549, H520 and H1650 lung cancer cells. A549 cells harbor a K-Ras mutation and are a lung adenocarcinoma cell line that exhibits primary resistance to gefitinib or erlotinib. This line has been well characterized and utilized to study a variety of molecular characteristics of human tumors. Based on this information, we chose A549 cells as the major cell model for these studies. The H520 and H1650 were used to confirm that ceftriaxone has a similar effect on other lung cancer cell lines. Ceftriaxone directly bound with Aurora B and suppressed its activity in vitro and in cells. Moreover, an in vivo animal study showed that ceftriaxone inhibited Aurora B activity to suppress tumor growth of A549 and H520 lung cancer cells implanted in nude mice. These data suggest that ceftriaxone has antitumor activities exhibited through the targeting of Aurora B and also provides new indications of ceftriaxone for lung cancer treatment.
Materials and methods
Reagents
Ceftriaxone was purchased from the University of Minnesota Boynton Health Services Pharmacy (Minneapolis, MN). Dulbecco’s modified Eagle’s medium, basal medium eagle and other supplements were from Life Technologies, Inc. (Carlsbad, CA). CNBr-Sepharose 4B beads were purchased from Amersham Pharmacia Biotech, Inc. (Piscataway, NJ). The human recombinant Aurora B and histone H3 proteins and the antibody used to detect phosphorylated histone H3 were purchased from Millipore Corp. (Billerica, MA). Antibodies used to detect Aurora B, phosphorylated Aurora B and histone H3 were from Cell Signaling Technology, Inc. (Danvers, MA). The small hairpin RNA (sh-RNA) construct against aurkb (sense sequence for human: CCTGCGTCTCTACAACTATTT, sense sequence for mouse: CCAGCAGAGGATCTACTTAAT) used in this study was from the University of Minnesota BioMedical Genomics Center.
Cell culture
Mouse epidermal JB6 P+ cells were cultivated in Eagle’s minimum essential medium supplemented with 5% heat-inactivated fetal bovine serum (FBS), 2mM l-glutamine, 25 µg/ml of gentamicin. H1975, H1650 and H520 cells were cultivated in RPMI-1640/10% FBS. Calu-3 and MRC-5 cells were maintained in Dulbecco’s modified Eagle’s medium/10% FBS. A549 cells were grown in F-12K medium/10% FBS. All cells used in these studies were purchased from the American Type Culture Collection (Manassas, VA) and maintained with antibiotics at 37°C in a 5% CO2 humidified incubator.
Kinase profiling. Kinase profiling was conducted by Millipore’s KinaseProfiler according to the protocols detailed at http://www.millipore.com/drugdiscovery/dd3/KinaseProfiler. The ceftriaxone concentration for each specific kinase assay was set at 100 µM and adenosine triphosphate (ATP) concentration was set at 10 µM.
Molecular modeling. Computer modeling of ceftriaxone and Aurora B was performed using the crystal structure of Aurora B, which was obtained from the RCSB Protein Data Bank (PDB entry 2VRX (17)). The structure was prepared using the Protein Preparation Wizard in Maestro v9.2. Hydrogen atoms were added consistently with a pH of 7 and all water molecules were removed. Then the structure was minimized with an RMSD cutoff value of 0.3 Å. The 3D structure of ceftriaxone was drawn and optimized in Maestro v9.2, whereas the chemical structure of ceftriaxone was prepared using the program LigPrep v2.5 and then assigned AMSOL partial atom charge. Ligand docking was accomplished using the program Glide v5.7 (18). The receptor grid was created with the centroid of the crystal ligand as the center of the grid. Flexible docking was performed with extra precision mode. The number of poses per ligand was set to 10 in postdocking minimization and at most 5 poses would be output. The other parameters were kept as default.
Western blot analysis
Cellular proteins were extracted using Radioimmunoprecipitation (RIPA) lysis buffer (50mM Tris-Cl pH 8.0, 150mM NaCl, 1% Nonidet P-40, 0.25% SOD, 0.1% sodium dodecyl sulfate, 1mM ethylenediaminetetraacetic acid (EDTA) and protease-inhibitor cocktail). Proteins were then separated bysodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) followed by transfer onto polyvinylidene di-fluoride membranes (Amersham Pharmacia Biotech). The membranes were incubated with the appropriate specific primary antibody and a horseradish peroxidase-conjugated secondary antibody. Protein bands were visualized using an enhanced chemiluminescence reagent (Amersham Biosciences Corp.).
In vitro kinase assay
A histone H3 protein was reacted with active Aurora B in the presence of different concentrations of ceftriaxone, 100 µM ATP and ×1 kinase buffer (50mM Tris-HCl pH 7.5, 10mM MgCl2, 1mM EDTA, 1mM dithiothreitol, 0.01% Brij 35; Cell Signaling Technology). The reactions were carried out at 30°C for 30min and stopped by adding ×6 SDS sample buffer. The proteins were boiled and then resolved by SDS-PAGE. Total histone H3 and phosphorylated histone H3 were detected by Western blot analysis using specific antibodies.
Cytotoxicity and anchorage-independent growth assay
For the cytotoxicity assay, JB6 P+ cells were seeded (2×104 per well) into 96-well plates. After incubation for 24h, cells were treated with different concentrations of ceftriaxone and incubated for another 24 or 48h. CellTiter96 Aqueous One Solution (20 µl; Promega) was then added and cells were incubated for an additional 1h at 37°C in a 5% CO2 incubator. Absorbance was read at an optical density of 492nm. For the anchorage-independent growth assay, cells (8×103 per well) were suspended in 1ml basal medium eagle/10% FBS/0.33% agar with different concentrations of ceftriaxone and plated on a layer of solidified basal medium eagle/10% FBS/0.5% agar with the same concentration of ceftriaxone as the bottom agar. The cultures were maintained at 37°C in a 5% CO2 incubator for 1 to 2 weeks, and colonies were counted under a microscope using the Image-Pro Plus software (v. 4) program (Media Cybernetics). All experiments were repeated three times.
In vitro ATP competitive binding assay and ex vivo pull-down assay
For the in vitro ATP competitive binding assay, a recombinant human Aurora B protein (200ng) was first incubated with different concentrations of ATP (10 or 100 µM) for 1h at 4°C and then incubated with ceftriaxone-conjugated Sepharose 4B (or Sepharose 4B only as a control) beads (50 µl, 50% slurry) in a ×1 reaction buffer (50 mMTris pH 7.5, 5mM EDTA, 150mM NaCl, 1mM dithiothreitol, 0.01% NP40, 2µg/ml bovine serum albumin and 0.02mM phenylmethylsulfonyl fluoride, protease inhibitor cocktail). For the ex vivo pull-down assay, A549 cell lysates (500µg) were incubated with ceftriaxone-conjugated Sepharose 4B (or Sepharose 4B only as a control) beads (50µl, 50% slurry) in a ×1 reaction buffer. After incubation with gentle rocking overnight at 4°C, the beads were washed five times with ×1 wash buffer (50mM Tris pH 7.5, 5mM EDTA, 150mM NaCl, 1mM dithiothreitol, 0.01% NP40, 0.02mM phenylmethylsulfonyl fluoride), and proteins bound to the beads were boiled and resolved by 10% SDS-PAGE followed by western blot analysis.
In vivo xenograft mouse model
Athymic nude mice (Cr:NIH(S), NIH Swiss nude, 6–9 weeks old) were purchased from Charles River. Animals were maintained under ‘specific pathogen-free’ conditions according to guidelines established by Research Animal Resources, University of Minnesota. Mice were randomly divided into three groups: (i) vehicle group (n = 8); (ii) 100mg/kg ceftriaxone-treated group (n = 8); (iii) no cells-injected group (n = 8) treated with 100mg/kg ceftriaxone. Group 3 was maintained as a negative control to observe any possible side effects of ceftriaxone. The experiment was repeated with A549 and H520 lung cancer cells, respectively. A549 or H520 cells were inoculated subcutaneously (2×106 cells) into the left flank of each mouse in the first two groups. Treatment was started when the tumors reached a mean tumor volume of 100mm3. For the ceftriaxone group, 2.5mg ceftriaxone, formulated in 500µl physiological saline, was administered to each mouse three times per week by intraperitoneal (i.p.) injection. For the vehicle group, 500 µl physiological saline was administered to each mouse three times per week by i.p. injection. The duration of the animal study was 57 days for A549 cells and 32 days for H520 cells. Tumor volume was calculated from measurements of 3 diameters of the individual tumor based on the following formula: tumor volume (mm3) = (length × width × height × 0.52). Mice were monitored until tumors reached 1cm3 total volume, at which time mice were euthanized and tumors were extracted. All studies were performed according to guidelines approved by the University of Minnesota Institutional Animal Care and Use Committee.
Immunohistochemistry analysis
Tumor tissues from the mice (vehicle- and 100mg/kg ceftriaxone-treated groups) were prepared for immunohistochemistry analysis of phosphorylated histone H3. Sections (5 µm) from 10% neutral formalin solution–fixed paraffin-embedded tissue were cut on silane-coated glass slides and then deparaffinized with xylene and dehydrated through a graded alcohol bath. The slides were incubated with 1:100 dilution of an antirabbit antibody in 10% normal goat serum at 4°C overnight to detect phosphorylated histone H3. Normal goat serum was used as a negative control. After washing three times with PBS for 5min, slides were incubated with a 1:200 dilution of a biotinylated antirabbit antibody for 1h in the dark. The slides were developed in diaminobenzidine and counterstained with a weak solution of hematoxylin stain. Images were captured and analyzed using the Image Pro-plus software (v. 4) program.
Statistical analysis
All quantitative data are presented as mean values ± standard deviation or standard error as indicated. Statistically significant differences were determined using the Student’s t-test or one-way analysis of variance. A P value of less than 0.05 was considered statistically significant.
Results
Ceftriaxone inhibits EGF-induced anchorage-independent growth of JB6 P+ cells
In clinical use, 2g of ceftriaxone produces an average peak concentration in serum of 262 µg /ml (19), which is equal to 396 µM. The chemical structure of ceftriaxone is shown in Figure 1A. To determine the cytotoxicity of ceftriaxone, different concentrations of the drug were used to treat JB6 P+ mouse epidermal cells (JB6 P+ cells) for 24 or 48h. Cytotoxicity was measured by MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay and the results indicated that ceftriaxone had no cytotoxicity toward JB6 P+ cells up to 2000 µM at either 24 or 48h (Figure 1B). Next, we investigated whether ceftriaxone had an effect on anchorage-independent growth of JB6 P+ cells. Anchorage-independent growth ability is a hallmark of in vitro transformed cells and cancer cells (20,21). Our results revealed that JB6 P+ cells treated with ceftriaxone formed fewer colonies compared with control cells treated with only epidermal growth factor (EGF) (Figure 1C). The magnification of representative photographs for the anchorage-independent growth assay is 25X. U0126, a well-known MEK (Mitogen activated protein kinase kinase) inhibitor (22), was used as a positive control. These results showed that ceftriaxone could attenuate EGF-induced anchorage-independent cell growth and was not cytotoxic at clinically relevant doses.
Fig. 1.
Ceftriaxone inhibits EGF-induced anchorage-independent growth of JB6 P+ cells. (A) Chemical structure of ceftriaxone. (B) Ceftriaxone is not toxic to JB6 P+ cells. Cells were treated with different concentrations of ceftriaxone for 24 or 48h and cytotoxicity was measured by MTS assay. Absorbance was read at an optical density of 492nm. Data are shown as mean ± standard deviation from triplicate experiments. (C) Ceftriaxone inhibits EGF-induced anchorage-independent growth of JB6 P+ cells. Cells were cultured with different concentrations of ceftriaxone for 1 week and then colonies were counted. The magnification of representative pictures for the anchorage-independent growth assay is 25X. Data are shown as mean ± standard deviation from triplicate experiments. The asterisk (*) indicates a significant (P < 0.05) decrease in colony formation with ceftriaxone compared with the untreated control group.
Kinase profiling identifies Aurora B as a potential target of ceftriaxone
Based on the previous data, the next step was to identify the potential cellular targets of ceftriaxone. In the EGF-induced signaling pathway, several molecules downstream of the epidermal growth factor receptor (EGFR) are activated by EGF, including the Ras/Raf/MEK and the phosphoinositide 3-kinase (PI3-K), Akt and mammalian target of rapamycin (mTOR) signaling pathways (23). To determine potential targets of ceftriaxone, 50 candidate kinases were selected from different kinase families. Kinase assays were conducted by Millipore’s KinaseProfiler according to their established protocols. Scores (Table I) represent the percent of control, which was derived from the following formula: % of control = [(sample − mean no enzyme)/(mean plus enzyme − mean no enzyme)] × 100. This means that ceftriaxone would enhance kinase activity if the score was higher than 100, whereas if the score was lower than 100, the activity would be suppressed. The results revealed (Table I) that Aurora B was the most relevant potential target of ceftriaxone compared with the other kinases tested. Accumulating evidence supports a critical role for Aurora B in cancer development, and therefore targeting Aurora B is regarded as a useful strategy in chemoprevention and cancer therapy (24). Our data suggested that ceftriaxone could inhibit Aurora B activity and Aurora B was a more potent target of ceftriaxone than other kinases.
Table I.
Kinase profiling results indicate that Aurora B is a potential target of ceftriaxone
| Ceftriaxone, 100 µM | Ceftriaxone, 100 µM | ||
|---|---|---|---|
| Abl(h) | 130 | GSK3β(h) | 89 |
| AMPKα1(h) | 95 | IGF-1R(h) | 106 |
| ASK1(h) | 115 | IKKα(h) | 105 |
| Aurora-A(h) | 87 | IKKβ(h) | 103 |
| Aurora-B(h) | 45 | JNK1α1(h) | 107 |
| CDK1/cyclinB(h) | 99 | JNK2α2(h) | 97 |
| CDK2/cyclinA(h) | 95 | MAPK1(h) | 108 |
| CDK3/cyclinE(h) | 110 | MAPK2(h) | 103 |
| CHK2(R145W)(h) | 100 | MEK1(h) | 100 |
| CSK(h) | 104 | Met(h) | 90 |
| c-RAF(h) | 106 | MKK4(m) | 111 |
| cSRC(h) | 138 | MKK6(h) | 105 |
| DYRK2(h) | 75 | MKK7β(h) | 101 |
| EGFR(h) | 101 | MSK1(h) | 108 |
| EGFR(L858R)(h) | 85 | MSK2(h) | 78 |
| EGFR(L861Q)(h) | 83 | mTOR(h) | 92 |
| EGFR(T790M)(h) | 100 | p70S6K(h) | 94 |
| EGFR(T790M, L858R)(h) | 93 | PDK1(h) | 109 |
| EphB1(h) | 114 | PKBβ(h) | 94 |
| FAK(h) | 112 | PKCα(h) | 73 |
| FGFR1(h) | 103 | Rsk2(h) | 107 |
| Flt3(D835Y)(h) | 88 | Src(T341M)(h) | 97 |
| Flt3(h) | 103 | Yes(h) | 103 |
| Fyn(h) | 100 | ZAP-70(h) | 105 |
| GSK3α(h) | 93 | PI3 Kinase (p110/p85)(m) | 101 |
Kinase assays were conducted by Millipore’s Kinase Profiler according to their protocols. Scores in the table represent % of control, which was derived from the formula: % control = [(sample − mean no enzyme)/(mean plus enzyme − mean no enzyme)] × 100. The ceftriaxone concentration for each specific kinase assay was set at 100 µM and ATP concentration was set at 10 µM. Data are representative of results from triplicate experiments.
Ceftriaxone specifically binds with Aurora B in vitro and ex vivo
After identifying the potential target of ceftriaxone, the next question was whether Aurora B could bind with ceftriaxone. To confirm this prediction, we constructed a computer docking model with Aurora B and ceftriaxone. Our results showed that ceftriaxone bound with Aurora B and fit into the ATP-binding site very well (Figure 2A). In the docked model of ceftriaxone and Aurora B (Figure 2B), ceftriaxone forms hydrogen bonds with ALA173 and LYS101 and maintains van der Waals contacts with the side chain of PHE172. To further validate this prediction, we performed an in vitro ATP competitive binding assay using ceftriaxone-conjugated Sepharose 4B beads. Results revealed that recombinant Aurora B was able to bind with ceftriaxone-conjugated Sepharose 4B beads and the binding affinity was decreased as ATP concentration was increased, which meant ceftriaxone could bind with Aurora B in an ATP competitive manner (Figure 2C). We also confirmed the ex vivo binding of ceftriaxone with endogenous Aurora B in A549 cells (Figure 2D). These results indicated that ceftriaxone could bind with Aurora B in vitro and in A549 cells, which clearly supports our hypothesis that Aurora B is an ‘off’ target of ceftriaxone.
Fig. 2.
Ceftriaxone specifically binds with Aurora B in vitro and ex vivo. (A) Proposed binding mode of ceftriaxone and Aurora B. Ceftriaxone is shown in stick representation and surrounded by a semitransparent surface, which occupies the ATP-binding site between the N and C terminals. (B) Interaction between ceftriaxone and Aurora B. Ceftriaxone forms hydrogen bonds with ALA173 and LYS101 and maintains van der Waals contacts with the side chain of PHE172. Carbons of ceftriaxone are colored magenta, whereas oxygen, nitrogen and sulfur are shown in red, blue and yellow, respectively. The in vitro ATP competitive binding (C) and ex vivo binding (D) of ceftriaxone with Aurora B were confirmed using a pull-down assay. A recombinant human Aurora B protein (200ng) or A549 cell lysates (500 µg) were incubated with ceftriaxone-Sepharose 4B (or Sepharose 4B only as control) beads. Proteins bounded to the beads were boiled and resolved by 10% SDS-PAGE followed by western blot analysis. Data shown are representative of triplicate experiments.
Ceftriaxone suppresses Aurora B activity in vitro and in cells
Based on our previous data showing that ceftriaxone directly binds with Aurora B, we performed an in vitro kinase assay with histone H3 as substrate to further confirm that ceftriaxone inhibits Aurora B activity. The results showed that phosphorylation of histone H3 (Ser10) was substantially attenuated after treatment with 10 µM ceftriaxone (Figure 3A). Reversine, a novel Aurora B inhibitor, was used as a positive control (25). In addition, we examined whether ceftriaxone could suppress Aurora B activity in JB6 P+ cells. Data indicated that phosphorylation of histone H3 (Ser10) was decreased by treatment with ceftriaxone in a dose-dependent manner (Figure 3B). In contrast, phosphorylation of histone H3 (Ser10) was increased slightly and phosphorylation of ERKs and JNKs showed no obvious change. To investigate whether the effects of ceftriaxone are mediated directly through Aurora B, we compared the effects of JB6 P+ cells transfected with an sh-mock or sh-Aurora B plasmid (Figure 3C). Ceftriaxone suppressed anchorage-independent growth in sh-mock cells but had less effect in sh-Aurora B cells (Figure 3D). Previous studies showed that phosphorylation of histone H3 (Ser10) is an essential regulatory mechanism for EGF-induced neoplastic cell transformation (26). Based on this finding, our results suggested that ceftriaxone suppresses anchorage-independent growth by inhibiting phosphorylation of histone H3 (Ser10).
Fig. 3.
Ceftriaxone suppresses Aurora B activity in vitro and in cells. (A) Ceftriaxone inhibits Aurora B activity in vitro. The inhibitory effect of ceftriaxone on Aurora B was determined by an in vitro kinase assay as described in section ‘Materials and methods’. The expression level of phosphorylated histone H3 (Ser10; arrow) was confirmed by western blot analysis using an antibody against phosphorylated histone H3. Total histone-H3 was used as a loading control. Data are representative of results from triplicate experiments. (B) Ceftriaxone inhibits Aurora B activity in JB6 P+ cells. Different concentrations of ceftriaxone were incubated with JB6 P+ cells for 2h and cells were then treated with 10ng/ml EGF for 30min. Cells were harvested and total ERKs, RSK, Aurora B, histone H3 and phosphorylated ERKs, RSK, p38, JNKs, Aurora B and histone H3 proteins were detected by western blotting using specific antibodies. Data are representative of results from triplicate experiments. (C) Expression level of Aurora B in JB6 P+ cells is decreased by knockdown of Aurora B. JB6 P+ cells were transiently transfected with sh-mock or sh-Aurora B and cell lysates were analyzed by western blotting. (D) Ceftriaxone has less effect on anchorage-independent cell growth of sh-Aurora B cells than that of sh-mock cells. JB6 P+ cells were grown in soft agar with ceftriaxone (0, 200, 500, 1000 µM) for 7 days and colonies were counted. Data are represented as mean ± standard deviation from triplicate experiments. The asterisk (*) indicates a significant decrease compared with sh-mock cells (P < 0.05).
Aurora B is highly expressed in lung cancer cell lines and ceftriaxone inhibits anchorage-independent growth of lung cancer cells
A large number of studies revealed that Aurora B is highly expressed in several human cancers including ovarian, colon and prostate (27–29). To determine whether Aurora B is highly expressed in human lung cancer cells, expression was compared in several human lung cancer cell lines and normal lung cells. The results revealed that compared with normal lung cells, Aurora B expression was higher in five different lung cancer cell lines (Figure 4A), which suggested that Aurora B might be associated with tumorigenesis and development of lung cancer. Next, we determined whether ceftriaxone could affect anchorage-independent growth of lung cancer cells. Cells were maintained with different concentrations of ceftriaxone and colony numbers were counted after culturing for 7–14 days. The results showed that A549, H520 or H1650 cells treated with ceftriaxone had a significant reduction in colony formation compared with untreated control cells (Figure 4B–D). The magnification of representative photographs for the anchorage-independent growth assay is 25X.
Fig. 4.
Aurora B is highly expressed in lung cancer cell lines and ceftriaxone inhibits their anchorage-independent growth. (A) Aurora B expression levels are higher in lung cancer cell lines compared with normal lung cells. Aurora B expression level was confirmed by western blot analysis using an antibody against Aurora B. α-Tubulin was used as a loading control. Data are representative of results from triplicate experiments. (B) Ceftriaxone inhibits anchorage-independent growth of A549 cells. Cells were cultured with different concentrations of ceftriaxone for 10 days and then colonies were counted. Data are shown as mean ± standard deviation from triplicate experiments. The asterisk (*) indicates a significant (P < 0.05) decrease in colony formation with ceftriaxone compared with the untreated control group. Reversine was used as a positive control. Ceftriaxone also inhibits anchorage-independent growth of H520 (C) and H1650 (D) cells. Cells were cultured with different concentrations of ceftriaxone for 7 days (H520) or 14 days (H1650) and then colonies were counted. The magnification of representative photographs for the anchorage-independent growth assay is 25X. Data are shown as mean ± standard deviation from triplicate experiments. The asterisk (*) indicates a significant (P < 0.05) decrease in colony formation with ceftriaxone compared with the untreated control group. Reversine was used as a positive control.
Aurora B is required for the inhibitory effects of ceftriaxone
In addition, to examine the mechanism explaining the inhibitory effect of ceftriaxone on anchorage-independent cell growth, western blot analysis was used to evaluate different molecular targets. As expected, phosphorylation of histone H3 (Ser10) was inhibited in a dose-dependent manner (Figure 5A), which suggested that ceftriaxone attenuated anchorage-independent growth of A549 cells by suppressing Aurora B activity. To investigate whether the effects of ceftriaxone are mediated directly through Aurora B, we compared the effects of A549 cells transfected with an sh-mock or sh-Aurora B plasmid (Figure 5B). Ceftriaxone suppressed anchorage-independent growth in sh-mock cells but had less effect in sh-Aurora B cells (Figure 5C). These results suggest that Aurora B is a direct target for ceftriaxone to suppress lung cancer cell growth.
Fig. 5.
Aurora B is required for the inhibitory effects of ceftriaxone. (A) Ceftriaxone inhibits Aurora B activity in A549 cells. A549 cells were treated with different concentrations of ceftriaxone for 2h. Cells were then harvested and total ERKs, RSK, Aurora B, histone H3 and phosphorylated ERKs, RSK, Aurora B and histone H3 proteins were detected by western blotting using specific antibodies. Data are representative of results from triplicate experiments. (B) Expression level of Aurora B in A549 cells is decreased by knockdown of Aurora B. A549 cells were transiently transfected with sh-mock or sh-Aurora B and cell lysates were analyzed by western blot. (C) Ceftriaxone has less effect on anchorage-independent cell growth of sh-Aurora B-transfected cells than that of sh-mock cells. A549 cells were grown in soft agar with ceftriaxone (0, 200, 500, 1000 µM) for 10 days and colonies were counted. Data are represented as mean ± standard deviation from triplicate experiments. The asterisk (*) indicates a significant decrease compared with sh-mock cells (P < 0.05).
Ceftriaxone suppresses tumor growth by inhibiting Aurora B activity in vivo
Based on our previous data, the next step was to determine whether ceftriaxone could suppress tumor growth in vivo. After injecting A549 or H520 cells into nude mice, the first measurable tumors were observed on day 12 or 14, respectively, and then mice were divided into two matched groups. Vehicle or ceftriaxone treatment was started when the tumors reached a mean tumor volume of 100mm3. Results indicated that the tumors treated with100mg/kg ceftriaxone grew significantly more slowly and the sizes of the tumors were smaller compared with the vehicle group (Figure 6A, Supplementary Figure 1A and B, available at Carcinogenesis Online). On day 56, the average tumor volume per mouse treated with 100mg/kg ceftriaxone was 116mm3 compared with 360mm3 in the vehicle group (Figure 6A). Similar differences were observed for H520 tumors—on day 32, the average tumor volume per mouse treated with 50mg/kg ceftriaxone was 130mm3 compared with 370mm3 in the vehicle group (Supplementary Figure 1B, available at Carcinogenesis Online). The average body weights of each group were similar throughout the study (Figure 6B, Supplementary Figure 1C, available at Carcinogenesis Online), which indicated that the dose of ceftriaxone used for the experiment had no toxicity to the mice. To further determine whether the antitumor effect of ceftriaxone was associated with its inhibition of Aurora B activity, tumor extracts from each group were prepared and analyzed for phosphorylation of histone H3. Immunohistochemistry analysis results showed that expression of phosphorylated histone H3 was substantially decreased in the ceftriaxone-treated group compared with the vehicle group (Figure 6C). The magnification of representative photographs for the immunohistochemistry staining is ×100. Overall, our results indicated that ceftriaxone suppresses tumor growth by inhibiting Aurora B activity in vivo.
Fig. 6.
Ceftriaxone suppresses tumor growth by inhibiting Aurora B activity in vivo. (A) Ceftriaxone treatment suppresses tumor volume compared with the vehicle-treated group. Tumor volume was measured and recorded as described in section ‘Materials and methods’. The asterisk (*) indicates a significant increased tumor size (P < 0.05) in the vehicle-treated group compared with the ceftriaxone-treated group as determined by one-way analysis of variance. (B) Ceftriaxone has no effect on the body weight of mice. The body weight of each mouse was measured and recorded once a week. Data are shown as mean ± satndard error. (C) Ceftriaxone inhibits expression of phosphorylated histone H3 in vivo. Immunohistochemistry analysis was used to determine the level of phosphorylated histone H3 in tumor tissues. Top, representative photos from each group; phosphorylated histone H3 is indicated by arrows. Bottom, percentage of phosphorylated histone H3 expression with ceftriaxone treatment compared with the vehicle group. The magnification of representative photos for the immunohistochemistry staining is ×100. Data are shown as mean ± standard deviation from triplicate experiments. The asterisks (**) indicate a significant (P < 0.01) decrease in phosphorylated histone H3 expression in the100mg/kg ceftriaxone-treated group compared with the vehicle-treated group. The duration of this animal study was 57 days. It was terminated when most untreated tumors reached 1 cubic centimeter per University of Minnesota IACUC guidelines.
Discussion
Lung cancer is the most common cause of cancer-related death in men and women worldwide, with an estimated 222, 520 new diagnoses and 157, 300 deaths in the United States in 2010 (30). The most common symptoms are shortness of breath, coughing (including coughing up blood) and weight loss (31). Several treatment options are available for lung cancer including radiation therapy, chemotherapy, surgery and targeted drug therapy. Some of the treatments, such as chemotherapy, weaken the immune system and make the body more prone to infection (32). Ceftriaxone, an FDA-approved third-generation cephalosporin antibiotic, which was used primarily for treatment of pneumonia, herein is reported to exert antitumor activities. Our data clearly show a role of ceftriaxone as a chemotherapeutic agent for lung carcinoma and strongly suggest that Aurora B as a potential therapeutic ‘off’ target of this drug.
Aurora kinases, a collection of highly related serine/threonine kinases, are comprised of Aurora A, B and C and are key regulators of mitosis performing vital functions in chromosome alignment, segregation and cytokinesis (33). As a member of Aurora kinase family, Aurora B is a chromosomal passenger protein critical for accurate chromosomal segregation, cytokinesis and regulation of the mitotic checkpoint (34). According to the literature, Aurora kinases have been shown to play important roles in regulating cell division. Inhibition of Aurora B kinase resulted in cell-cycle arrest or even cell death (35). Azzariti et al. (36) reported that AZD1152, a specific Aurora B inhibitor, suppressed chromosome alignment and segregation in both colon and pancreatic cancer cell lines, resulting in increased chromosome number and cellular apoptosis. Recently, Lee et al. found that reversine, a well-known Aurora B inhibitor, suppressed oral squamous cell growth by interfering with the progression of the cell cycle (37). To determine whether ceftriaxone has a similar effect in A549 cells, different concentrations of ceftriaxone were used to treat A549 cells for 12h, and changes in cell-cycle distribution were examined. Consistent with the report by Lee et al., our data show that the percentage of G2/M cells slightly increased after treatment with high doses (500 µM) of ceftriaxone, which suggests that ceftriaxone induces G2/M arrest of A549 cells (Supplementary Figure 2), available at Carcinogenesis Online). Previous studies showed that Aurora B directly phosphorylates histone H3 not only at Ser10 but also at Ser28, resulting in mitotic chromosome condensation (38). However, accumulating evidence indicates that Aurora B is highly expressed in several malignancies. Progressive increases in the nuclear expression of Aurora B is observed in prostate cancers with increasing Gleason grades compared with normal prostate (39). Inappropriate phosphorylation of histone H3 in the entire cell cycle enhances proliferation of liver cancer cells (40), which suggested aberrant expression of Aurora B might be involved in hepatocarcinogenesis. Previous studies provided immunohistochemical evidence showing that Aurora B is overexpressed in lung cancer tissues compared with normal adjacent tissues (41). Consistent with this report, our results also showed that Aurora B expression is higher in several lung cancer cell lines, including A549, Calu-3 and H520 cells, compared with MRC-5 normal lung cells (Figure 4A). Moreover, inhibiting Aurora B by ceftriaxone suppressed anchorage-independent growth of A549, H520 and H1650 cells (Figure 4B–D). These results suggest Aurora B might play a significant role in lung cancer cell growth.
Aurora B is only expressed during mitosis and most normal cells in the human body do not proliferate rapidly. Thus, a number of Aurora B inhibitors, including JNJ-7706621, Hesperadin and PHA-739358 (34,42,43), were selected because they could have a broader therapeutic effect than non-specific cytotoxic agents. A number of Aurora B inhibitors have demonstrated antitumor activity and some, such as AZD 1152, have subsequently entered clinical trials. However, neutropenia was observed in a Phase I trial (44), suggesting that this agent had antiproliferation toxicity on the bone marrow. Therefore, finding Aurora B inhibitors, which are highly effective in suppressing Aurora B activity with low toxicity, is urgent and beneficial. Here we found that ceftriaxone, an FDA-approved cephalosporin antibiotic, specifically bound with Aurora B (Figure 2A–D) and suppressed its activity (Figure 3A and 3B) in vitro and in cells. Moreover, knockdown Aurora B decreases the inhibitory effects of ceftriaxone in anchorage-dependent growth of JB6 P+ (Figure 3D) and A549 (Figure 5D) cells. Importantly, an in vivo xenograft animal model showed that ceftriaxone suppressed A549 and H520 lung cancer tumor growth by inhibiting Aurora B activity (Figure 6, Supplementary Figure 1, available at Carcinogenesis Online). These results suggest that Aurora B is a secondary or ‘off’ target protein of ceftriaxone, which suppresses lung carcinoma progression.
In conclusion, we showed that Aurora B is highly expressed in lung cancer cell lines. Moreover, we provided evidence showing that ceftriaxone effectively suppresses anchorage-independent cell growth of lung cancer cells and in vivo tumor growth of A549 cells by inhibiting Aurora B activity. Overall, our findings support the anticancer efficacy of ceftriaxone through its targeting of Aurora B for the treatment of lung carcinomas.
Supplementary material
Supplementary Figures 1 and 2 can be found at http://carcin.oxfordjournals.org/.
Funding
The Hormel Foundation and National Institutes of Health (R37 CA081064, CA120388, ES016548, CA0227501); National Cancer Institute Contract No. HHSN-261200533001C-NO1-CN-53301.
Supplementary Material
Acknowledgement
We thank Tonya Poorman for help submitting our manuscript.
Conflict of Interest Statement: None declared.
Glossary
Abbreviations:
- ATP
adenosine triphosphate
- EDTA
ethylenediaminetetraacetic acid
- EGFR
epidermal growth factor receptor
- ERK
extracellular signal-regulated kinase
- JNK
c-jun NH2-terminal kinases
- MAPK
mitogen-activated protein kinase
- SDS-PAGE
sodium dodecyl sulfate–polyacrylamide gel electrophoresis.
References
- 1. Tobinick E.L. (2009). The value of drug repositioning in the current pharmaceutical market. Drug News Perspect. 22 119–125 [DOI] [PubMed] [Google Scholar]
- 2. Giacomini K.M. et al. (2007). When good drugs go bad. Nature 446 975–977 [DOI] [PubMed] [Google Scholar]
- 3. Hopkins A.L. (2008). Network pharmacology: the next paradigm in drug discovery. Nat. Chem. Biol. 4 682–690 [DOI] [PubMed] [Google Scholar]
- 4. Bisson W.H. et al. (2007). Discovery of antiandrogen activity of nonsteroidal scaffolds of marketed drugs. Proc. Natl. Acad. Sci. U.S.A. 104 11927–11932 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Kridel S.J. et al. (2004). Orlistat is a novel inhibitor of fatty acid synthase with antitumor activity. Cancer Res. 64 2070–2075 [DOI] [PubMed] [Google Scholar]
- 6. Pemble C.W. IV et al. (2007). Crystal structure of the thioesterase domain of human fatty acid synthase inhibited by Orlistat. Nat. Struct. Mol. Biol. 14 704–709 [DOI] [PubMed] [Google Scholar]
- 7. Little J.L. et al. (2007). Inhibition of fatty acid synthase induces endoplasmic reticulum stress in tumor cells. Cancer Res. 67 1262–1269 [DOI] [PubMed] [Google Scholar]
- 8. Ouyang W. et al. (2008). PI-3K/Akt pathway-dependent cyclin D1 expression is responsible for arsenite-induced human keratinocyte transformation. Environ. Health Perspect. 116 1–6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Richardson R.D. et al. (2008). Synthesis of novel beta-lactone inhibitors of fatty acid synthase. J. Med. Chem. 51 5285–5296 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Flanders S.A. et al. (2006). Effectiveness of ceftriaxone plus doxycycline in the treatment of patients hospitalized with community-acquired pneumonia. J. Hosp. Med. 1 7–12 [DOI] [PubMed] [Google Scholar]
- 11. Khrianin A.A. et al. (2006). [Rocefin (ceftriaxone) in therapy of uncomplicated gonorrhea in males]. Antibiot. Khimioter. 51 35–37 [PubMed] [Google Scholar]
- 12. Molyneux E. et al. (2011). 5 versus 10 days of treatment with ceftriaxone for bacterial meningitis in children: a double-blind randomised equivalence study. Lancet 377 1837–1845 [DOI] [PubMed] [Google Scholar]
- 13. Tomberg J. et al. (2010). Molecular and structural analysis of mosaic variants of penicillin-binding protein 2 conferring decreased susceptibility to expanded-spectrum cephalosporins in Neisseria gonorrhoeae: role of epistatic mutations. Biochemistry 49 8062–8070 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Ci X. et al. (2008). Ceftiofur impairs pro-inflammatory cytokine secretion through the inhibition of the activation of NF-kappaB and MAPK. Biochem. Biophys. Res. Commun. 372 73–77 [DOI] [PubMed] [Google Scholar]
- 15. McCubrey J.A. et al. (2007). Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance. Biochim. Biophys. Acta 1773 1263–1284 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Sebolt-Leopold J.S. et al. (2004). Targeting the mitogen-activated protein kinase cascade to treat cancer. Nat. Rev. Cancer 4 937–947 [DOI] [PubMed] [Google Scholar]
- 17. Girdler F. et al. (2008). Molecular basis of drug resistance in aurora kinases. Chem. Biol. 15 552–562 [DOI] [PubMed] [Google Scholar]
- 18. Friesner R.A. et al. (2006). Extra precision glide: docking and scoring incorporating a model of hydrophobic enclosure for protein-ligand complexes. J. Med. Chem. 49 6177–6196 [DOI] [PubMed] [Google Scholar]
- 19. Salvador P. et al. (1983). Clinical pharmacology of ceftriaxone in patients with neoplastic disease. Antimicrob. Agents Chemother. 23 583–588 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Freedman V.H. et al. (1974). Cellular tumorigenicity in nude mice: correlation with cell growth in semi-solid medium. Cell 3 355–359 [DOI] [PubMed] [Google Scholar]
- 21. Wang L.H. (2004). Molecular signaling regulating anchorage-independent growth of cancer cells. Mt. Sinai J. Med. 71 361–367 [PubMed] [Google Scholar]
- 22. Namura S. et al. (2001). Intravenous administration of MEK inhibitor U0126 affords brain protection against forebrain ischemia and focal cerebral ischemia. Proc. Natl. Acad. Sci. U.S.A. 98 11569–11574 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Herbst R.S. et al. (2008). Lung cancer. N. Engl. J. Med. 359 1367–1380 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Portella G. et al. (2011). Aurora B: a new prognostic marker and therapeutic target in cancer. Curr. Med. Chem. 18 482–496 [DOI] [PubMed] [Google Scholar]
- 25. D’Alise A.M. et al. (2008). Reversine, a novel Aurora kinases inhibitor, inhibits colony formation of human acute myeloid leukemia cells. Mol. Cancer Ther. 7 1140–1149 [DOI] [PubMed] [Google Scholar]
- 26. Dong Z. et al. (2006). The role of histone H3 phosphorylation (Ser10 and Ser28) in cell growth and cell transformation. Mol. Carcinog. 45 416–421 [DOI] [PubMed] [Google Scholar]
- 27. Sorrentino R. et al. (2005). Aurora B overexpression associates with the thyroid carcinoma undifferentiated phenotype and is required for thyroid carcinoma cell proliferation. J. Clin. Endocrinol. Metab. 90 928–935 [DOI] [PubMed] [Google Scholar]
- 28. Tatsuka M. et al. (1998). Multinuclearity and increased ploidy caused by overexpression of the aurora- and Ipl1-like midbody-associated protein mitotic kinase in human cancer cells. Cancer Res. 58 4811–4816 [PubMed] [Google Scholar]
- 29. Chen Y.J. et al. (2009). Overexpression of Aurora B is associated with poor prognosis in epithelial ovarian cancer patients. Virchows Arch. 455 431–440 [DOI] [PubMed] [Google Scholar]
- 30. Jemal A. et al. (2010). Cancer statistics, 2010. CA. Cancer J. Clin. 60 277–300 [DOI] [PubMed] [Google Scholar]
- 31. Fox S.W. et al. (2006). Symptom clusters and quality of life in survivors of lung cancer. Oncol. Nurs. Forum 33 931–936 [DOI] [PubMed] [Google Scholar]
- 32. Vento S. et al. (2008). Lung infections after cancer chemotherapy. Lancet Oncol. 9 982–992 [DOI] [PubMed] [Google Scholar]
- 33. Adams R.R. et al. (2001). Chromosomal passengers and the (aurora) ABCs of mitosis. Trends Cell Biol. 11 49–54 [DOI] [PubMed] [Google Scholar]
- 34. Hauf S. et al. (2003). The small molecule Hesperadin reveals a role for Aurora B in correcting kinetochore-microtubule attachment and in maintaining the spindle assembly checkpoint. J. Cell Biol. 161 281–294 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Li Y. et al. (2010). VX680/MK-0457, a potent and selective Aurora kinase inhibitor, targets both tumor and endothelial cells in clear cell renal cell carcinoma. Am. J. Transl. Res. 2 296–308 [PMC free article] [PubMed] [Google Scholar]
- 36. Azzariti A. et al. (2011). Aurora B kinase inhibitor AZD1152: determinants of action and ability to enhance chemotherapeutics effectiveness in pancreatic and colon cancer. Br. J. Cancer 104 769–780 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Lee Y.R. et al.(2012)Reversine suppresses oral squamous cell carcinoma via cell cycle arrest and concomitantly apoptosis and autophagy. J. Biomed. Sci. 199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Goto H. et al. (2002). Aurora-B phosphorylates Histone H3 at serine28 with regard to the mitotic chromosome condensation. Genes Cells 7 11–17 [DOI] [PubMed] [Google Scholar]
- 39. Chieffi P. et al. (2006). Aurora B expression directly correlates with prostate cancer malignancy and influence prostate cell proliferation. Prostate 66 326–333 [DOI] [PubMed] [Google Scholar]
- 40. Sistayanarain A. et al. (2006). Expression of Aurora-B kinase and phosphorylated histone H3 in hepatocellular carcinoma. Anticancer Res. 26(5A)3585–3593 [PubMed] [Google Scholar]
- 41. Hayama S. et al. (2007). Phosphorylation and activation of cell division cycle associated 8 by aurora kinase B plays a significant role in human lung carcinogenesis. Cancer Res. 67 4113–4122 [DOI] [PubMed] [Google Scholar]
- 42. Carpinelli P. et al. (2007). PHA-739358, a potent inhibitor of Aurora kinases with a selective target inhibition profile relevant to cancer. Mol. Cancer Ther. 6(12 Pt 1)3158–3168 [DOI] [PubMed] [Google Scholar]
- 43. Emanuel S. et al. (2005). The in vitro and in vivo effects of JNJ-7706621: a dual inhibitor of cyclin-dependent kinases and aurora kinases. Cancer Res. 65 9038–9046 [DOI] [PubMed] [Google Scholar]
- 44. Keizer R.J. et al. (2012). Two-stage model-based design of cancer phase I dose escalation trials: evaluation using the phase I program of barasertib (AZD1152). Invest. New Drugs 30 1519–1530 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






