Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of the oligonucleotides used to obtain the Gp96 variants
| Name | Primer sequences (5′ to 3′) |
|---|---|
| Gp96-NS-fwd | ggaattcgacgatgaagttgatgtgg |
| Gp96-NS- rev | ccctgcagtcacaattcagaagttgactgg |
| Gp96-CL-fwd | ggaattctcaaaacacaacaacatacc |
| Gp96-CL-rev | ccctcgagttacaattcatctttttcagc |
| Gp96-N-fwd | ggaattcgacgatgaagttgatgtgg |
| Gp96-N-rev | ccctcgagtcaaatgtcagttgg |
| Gp96-C-fwd | ggaattcactagcctagacca |
| Gp96-C-rev | ccctcgagttacaattcatctttttcagc |
