Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of primers and probes for qPCR analysis.
| Target mRNA | Primer sequence | TaqMan™ Probe |
|---|---|---|
| gapdh | F- agccacatcgctcagacac R- gcccaatacgaccaaatcc |
60 |
| gp96 | F- ctggaaatgaggaactaacagtca R- tcttctctggtcattcctacacc |
62 |
| tlr2 | F- cgttctctcaggtgactgctc R-cctttggatcctgcttgc |
14 |
| tlr4 | F- ggtttagaagtccatcgtttgg R- cacaggccctctagagcaga |
14 |
| tlr5 | F- attgagaatgttggcgctgt R- tggtgaatcaggagaaaggact |
80 |
| tlr9 | F- tgtgaagcatccttccctgta R- gagagacagcgggtgcag |
56 |
