Table 2.
Primer sequences used in amplifying species-specific microsatellite genomic regions in A. catenella and A. tamarense.
| Primer | Nucleotide sequence 5′ to 3′ | Annealing temperature (°C) | Species | Reference |
|---|---|---|---|---|
| Acat02-F | caagtgaactaaatccgct | 60 | A. catenella | Nagai et al. (2005) |
| Acat02-R | aaaacggaatgtttatgtgc | |||
| Acat16-F | tgtctttcttcctgcctgcctt | 60 | A. catenella | Nagai et al. (2005) |
| Acat16-R | ttcaccccagcgaagccattatg | |||
| Acat20-F | aggagaaaagtgatgcatctcagcaa | 60 | A. catenella | Nagai et al. (2005) |
| Acat20-R | aatcctgtggatgatggaaggtactg | |||
| Acat44-F | tgccccataagggttcttccaga | 60 | A. catenella | Nagai et al. (2005) |
| Acat44-R | gacagtggtattgcaaacccaacggat | |||
| ATB1-F | cgcctgctcgagaaaaga | 53 | A. tamarense | Alpermann et al. (2006) |
| ATB1-R | ttgggggacagttgagtttc | |||
| ATB8-F | cagggtagccgatcaaacac | TD 61–54 (−0.3) | A. tamarense | Alpermann et al. (2006) |
| ATB8-R | cttccatcgccttgcatact | |||
| ATD8-F | caacactggaagcgtgctaa | TD 61–54 (−0.3) | A. tamarense | Alpermann et al. (2006) |
| ATD8-R | cccatgcgctacctcttaca | |||
| ATF11-F | agcagcgcggcgggagatt | TD 68.5–61 (−0.3) | A. tamarense | Alpermann et al. (2006) |
| ATF11-R | acctgcggctgcgacacgact |
The annealing temperature for each primer, the species and the study from which the sequences were obtained are listed.
TD, touchdown.