Skip to main content
. 2012 Dec 19;7(12):e52567. doi: 10.1371/journal.pone.0052567

Figure 1. hCG-β mRNA expression in human retina.

Figure 1

Expression of housekeeping beta-actin was comparable between samples (3–6). Expression of hCG-β was detected in all tested samples (9–12) with the exception of negative control (8). hCG-β mRNA was found in whole human retina (10), Müller glia cell line (11) and RPE cells (12). β-hCG expression was significantly lower than in human placenta (9). Amplification products were generated at the expected size (196 bp for hCG-β using primers GTCAACACCACCATCTGTGC and GGCAGAGTGCACATTGACAG, NM_000737). 1, 7, 13: DNA ladder (100 bp); 2–3: Housekeeping cDNA amplification (beta actin); 8–12: hCG-β cDNA amplification; 2, 8: negative control; 3, 9: Human placenta; 4, 10: Human retina; 5, 11: Immortalized human Müller glia cell line (MIO-M1); 6, 12: Primary human retinal pigmented epithelial (RPE) cells.