Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Proteins | Forward primer | Reverse primer |
| Gal-3 | agccatatggcagacaatttttc | tgggatccagattatatcatggtat |
| G13-250 | taacatatggggtctggaaaccaa | tgggatccagattatatcatggtat |
| G69-250 | taacatatggcttatcccggagca | tgggatccagattatatcatggtat |
| G111-250 | ttacatatggctgggccactgatt | tgggatccagattatatcatggtat |
| GST-Gal-3 | ataggatccgcagacaatttttcgct | ggcgaattcagattatatcatgg |
| GST-G1-108 | ataggatccgcagacaatttttcgct | tagaattcttagccataggggcca |
