Table 1.
Oligonucleotide primers used in the hierarchical oligonucleotide primer extension assay to determine the relative abundance of microbial populations in the terephthalate-degrading biofilm in this study
| Primer | Target | Sequence (5′–3′)a | Length (nt) |
Extension |
Tube | Source or reference | ||
|---|---|---|---|---|---|---|---|---|
| Binding | Tail | Allele | Color | |||||
| EUB338F | Bacteria | (gtac)7ACTCCTACGGGAGGCAG | 17 | 28 | C | Black | 1,2 | Modified from Amann et al. (16) |
| TA828f | Syntrophorhabdus | GGTGTGGGAGGTGTAATA | 18 | 0 | C | Black | 1 | This study |
| DFM230r | Pelotomaculum | GCTAATGGGACGCGGACC | 18 | 0 | C | Black | 1 | Modified from Loy et al. (17) |
| OP5-80f | Caldisericum | TCTCTGATAAGGGTGCTGGC | 20 | 0 | G | Blue | 1 | This study |
| Syb459f | Syntrophobacter | GGAGGAATATGCTCTGTG | 18 | 0 | A | Green | 2 | This study |
| Syn742r | Syntrophus | CGCGTCTCAGCGTCAGTATAGGA | 23 | 0 | C | Black | 2 | This study |
| OP8-466r | Candidate division OP8 | GAGGGTACCGTCAGTCCCT | 19 | 0 | T | Red | 2 | This study |
| MCD823f | Methylocaldum | AACTAGCCGTTGGGCACAAT | 20 | 0 | T | Red | 2 | This study |
| TA758f | Candidate division WWE1 | (atgc)2AACTGCGAAGGTGTGGGGAT | 20 | 8 | C | Black | 2 | This study |
| ARC911fm | Archaea | (cgta)6TAAAGGAATTGGCGCGG | 17 | 24 | G | Blue | 3 | Modified from Narihiro et al. (18) |
| MX802f | Methanosaeta | GTCCTAGCCGTAAACGTAA | 19 | 0 | C | Black | 3 | This study |
| ML398fm | Methanolinea | CCCGAGTGCCCGTAAATTC | 19 | 0 | G | Blue | 3 | This study |
a
Lowercase letters represent tail sequences.