Skip to main content
. Author manuscript; available in PMC: 2014 Feb 1.
Published in final edited form as: Mol Oral Microbiol. 2012 Oct 12;28(1):1–17. doi: 10.1111/omi.12005

Figure 6. Genetic map of sagB/tkt operon in HK1651 and ANH9381.

Figure 6

The dash-lines indicate the homologous regions. ORFs are noted and indicated by blue (forward) or green (reverse) pentagons. An insertion of a 223 bp fragment flanked by 48-bp/49-bp repeats (indicated by light blue boxes) is found in HK1651, while only the 49-bp element was found in the comparable region in ANH9381. It was noted that the tkt (transketolase N-terminal section) was truncated in HK1651 (annotated at OralGen as two overlapping genes of AA02564 and AA02565) but intact in ANH8381. Here is the location of each repeat in HK1651 and ANH9381 genomes

>hk1651-repeat-1 (1788949-1788997)

TCCACGCTTGGACCGACACAAGCAAAAGCGCGGATGCTTGCGCTATCAT

>hk1651-repeat-2 (1789221-1789268)

TCCACGCTTGGACCGGATAAGCACTAGCGCGGACGCTTGCGCTATCAT

>anh9381-repeat-1 (1922975-1923023)

TCCACGCTTGGACCGACACAAGCAAAAGCGCGGATGCTTGCGCTATCAT