Table 4.

Primer sequences

Primer	Sequence (5′-3′)	Amplicon (bp)	Cycling conditions	Reference
Multiplex PCR:
LES1nestF	tttggtgatgatcggcttagc	289	95°C, 4 min then 30 cycles: 95°C, 30 s; 58°C, 30 s; 72°C, 30 s; final extension step, 72°C, 7 min;	[25]
LES1nestR	tgtggaagcgatcagtct
Clust6nestF	ggatcgacgtggcataatctg	410		[25]
Clust6nestR	acgattctccggcatgcagcg
4tot1F	gctcatgagtggctgacaac	105		This study
4tot1R	tcttgggcagagaaccattc
Q-PCR:
2pro3F	caagccctgtctggattttc	102	95°C, 10 min; then 40 cycles: 95°C, 10 s; 60°C, 15 s; 72°C s.	This study
2pro3R	gagacaggttgggagggagt
3tot1F	cgcaggtaccaccagacttt	122		This study
3tot1R	catgtccagcaggttcaaaa
3pro3F	gcggatgttctcaaacgaat	134		This study
3pro3R	cgggagaagcaatgacctac
4tot1F	gctcatgagtggctgacaac	105		This study
4tot1R	tcttgggcagagaaccattc
4pro3F	tcgtgctgtgctgatctttt	172		This study
4pro3R	agcagtgccagttgatgttg
Preparation of DIG-labeled probes:
φ2intDIGF	tgcctatctaacggggttca	1097	95°C, 4 min. 30 cycles: 95°C, 30 s; 55°C, 30 s; 72°C, 1 min s; final extension step, 72°C, 7 min	This study
φ2intDIGR	gaagcaaccgagaagtggag
φ3intDIGF	ggatcatgtagcgggaaaga	874		This study
φ3intDIGR	agaacctggcgaaagtctga
φ4cIDIGF	atcgttaattggcacggaat	893		This study
φ4cIDIGR	acagcaacggatttccactc

tot = to quantify total phage copies; pro = to quantify total phage copies.