Fig. 2.

Analysis of APUM5 binding to CMV RNAs both in vitro and in vivo. (A) The 3′ UTR sequence of CMV RNA 1 (3201–3210 nt), 2 (2884–2913 nt), and 3 (2139–2168 nt) contains the APUM5 binding motif that interacts with GST–APUM5–PHD protein. GST protein was used as a negative control. Drosophila hbNRE2 interacts with GST–APUM5–PHD protein. (B) Competition assay for the CMV 3′ UTR binding motif. The 10 nM GST–APUM–PHD protein was incubated with ³²P-labeled CMV 3′ UTR RNA and various amount of unlabeled CMV 3′ UTR RNA were indicated at the top. (C) Competition assay with various amount of unlabeled nonspecific RNA (UCCUGGCCUGGAAAAUCCUGACUUUCGCGU). The relative band intensity was quantified using the ImageJ software. (D) Specific binding analysis of the core binding motif sequence in CMV 3′ UTR. Mutant RNA sequences are indicated at the top of the panel and 10 fM RNA was incubated in each reaction with 10 nM GST–APUM5–PHD protein. (E) GST–APUM5–PHD protein also interacts with some (CMV RNA motif 1B, 3A, and 3B), but not all, putative UGUA-containing sequences in internal CMV RNA genomes. Single and double asterisks indicate RNA-protein complexes and free probes, respectively. (F) RNA coimmunoprecipitation experiment. The 35S–APUM5–GFP and 35S–GFP constructs were agro-infiltrated into the CMV-infected Nicotiana benthamiana leaves. After 5 d, total proteins were extracted and immunoprecipitated with monoclonal GFP antibody. Bound RNAs were recovered. Expression of APUM5–GFP (∼133 kDa) and GFP (26 kDa) in the plant was confirmed by protein blot analysis for each fraction. Recovered RNAs were converted to cDNA and then subjected to qRT-PCR with CMV RNA (+) or (−) strand-specific primers. Error bars indicate mean ± SD (n = 5). Significant differences (Student t test; *P < 0.05, **P < 0.01) are indicated by asterisks.