Table 1.

Primers used to design and validate transgenic rats expressing E46K mutated α-synuclein.

1.1. Primers designed to create the AB box. Capitalized “Outside primers” indicate attached base pairs to create restriction sites. “Inside primers” indicate the total size of the PCR sequence.
Outside primers	A Box Forward	GGCGCGCCgatggtctcgatctcctgac
	B Box Reverse	TTAATTAAcactctcatcctcatcttcctc
Inside primers	E46K A Box Reverse	ccatggacgacgcccttcttggttttggagcctac	596bp
	E46K B Box Forward	aagaagggcgtcgtccatggtgtggcaacaggtaagc	700bp

1.2. Primers designed to sequence the six α-synuclein exons and their surrounding intronic regions. The size of the PCR sequence is also given.
Exon	5’ Forward primer 3’	5’ Reverse primer 3’	Size
1	gagatagggacgaggagcac	ggacgaaagccaggtcaagtc	740bp
2	gccaagatggatgggagatg	tcacaggggcatatcaaagtc	778bp
3*	gagttcatgccattcttctg	cttttgcttcaccacatctgc	1508bp
4	gttgtgggcacctgtaatcc	atttgcatggcatttatctgg	937bp
5	aaatgatccacctgcctcag	tcttcatcttcctcctcctc	707bp
6	taactctgactactactactg	ccacaaaatccacagcacac	492bp

^(*)indicates that this primer sequence pair surrounds the region containing the mutated exon.