TABLE 1.
Bacterial strains, plasmids, and primers used in this study
| Strain, plasmid, or primer | Description | Reference or source |
|---|---|---|
| K. pneumoniae | ||
| 43816 | Serotype O1:K2 | ATCC |
| 43816-01 | 43816 with a plasmid cointegrate in wbbO | This study |
| CWK2 | An O1:K− strain used as a positive control for LPS electrophoresis analysis | 24 |
| E. coli | ||
| BW20677 | E. coli for conjugation of suicide plasmid pLD55, pir+ | 14 |
| DH5α | F−φ80lacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK−,mK+) phoA supE44 thi-1 gyrA96 relA1 λ− | Invitrogen |
| Plasmids | ||
| pWW84 | pUC containing kanamycin resistance cartridge | 16 |
| pBC KS+ | pBluescript with chloramphenicol resistance cassette | Stratagene |
| pLD55 | pBluescript II (SK+) F1(+)ori lacZαTetsoriRR6Kλ | 14 |
| Primers | ||
| 5′ wbbO (internal fragment) | CGGGATCCGGTGCAGGCATTAATCCAGAGA (BamH1 site underlined) | This study |
| 3′ wbbO (internal fragment) | ACGCGTCGACACCCATTTCAACACGTGCTTTAGG (Sal1 site underlined) | This study |