Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers and TaqMan probes used for the c.1303G>A (p.G435R) mutation screening
| Primer/probe | Sequence (5′ → 3′) | Reporter (5′) | Quencher (3′) | Final concentration (nM) |
|---|---|---|---|---|
| Forward primer | AACTCATCATCAGGCTGTTAACTTCA | – | – | 450 |
| Reverse primer | TGCCTCTGGAAATGGTCACAAG | – | – | 450 |
| Wild-type probe | CACCCCGTGGCAAA | VIC | NFQ | 100 |
| Mutant-type probe | CACCCTGTGGCAAA | FAM | NFQ | 100 |
VIC 6-carboxyrhodamine, FAM 6-carboxyfluorescein, NFQ nonfluorescent quencher
