Table 1.
Strains, plasmids, and primers used in this study
| Strain, plasmid, or primer | Genotype, relevant properties, or sequence (5′–3′) | Source |
|---|---|---|
| Strains | ||
| E. coli BL21(DE3) | F− ompT hsdSB(rB− mB−) gal dcm (DE3) | Invitrogen |
| P. pentosaceus | ||
| FAM13073 | Tilsit | |
| FAM17622 | dsdA mutant (deletion at position 107) | Gruyère |
| FAM18813 | Tête de Moine | |
| FAM19080 | dsdA mutant (amino acid substitutions T67A and P278La) | Gruyère |
| FAM19132 | Gruyère | |
| FAM19144 | dsdA mutant (deletion from positions 90 to 108) | Sbrinz |
| FAM19169 | Tilsit | |
| FAM20650 | dsdA mutant (nonsense mutation C → T at position 151) | Emmentaler |
| DSM 20336 | Type strain | German Collection of Microorganisms and Cell Cultures |
| P. acidilactici | ||
| FAM13473 | Emmentaler | |
| FAM13881 | Emmentaler | |
| FAM17411 | Gruyère | |
| FAM17418 | Gruyère | |
| FAM17422 | Gruyère | |
| FAM18098 | Gruyère | |
| FAM18987 | Tête de Moine | |
| FAM19460 | Emmentaler | |
| FAM20559 | Gruyère | |
| DSM 20284 | Type strain | German Collection of Microorganisms and Cell Cultures |
| Plasmids | ||
| pEXP5-CT/TOPO | E. coli cloning vector, Ampr | Invitrogen |
| pEXP5-CT/dsdA[19132] | Plasmid expressing dsdA from FAM19132, Ampr | This study |
| pEXP5-CT/dsdA[19080] | Plasmid expressing dsdA from FAM19080, Ampr | This study |
| Primersb | ||
| PEPE_1745F | ATGATTGATGTTGATGCTCTA | |
| PEPE_1745R | TTTAACTTGATGTCCTTCAG |
a
Compared to PEPE_1745 from P. pentosaceus ATCC 25745.
b
Primers were used for cloning and sequencing of dsdA.