Table 1. The primer sequences for microarray.

Primersa	Sequence(5′-3′)f	Location	Targeted genesg	Targeted viruses
NF1-1	CAAGAGTCTGAATGTGCATG	699–718c	Neuraminidase	2009 influenza A (H1N1)
NF1-2	CAAGAGTCTGAATGTGTCTG	699–718c	Neuraminidase	Seasonal influenza A (H1N1)
NF1-3	CTGACCAACACCACCATA	221–238d	Neuraminidase	Influenza A (H3N2)
NR2-1b	GGATCCCAAATCATCTCAAA	1131–1150c	Neuraminidase	2009 influenza A (H1N1) Seasonal influenza A (H1N1)
NR2-2b	CATCAATAGGGTCCGATA	482–499d	Neuraminidase	Influenza A (H3N2)
MF2-1	CGAATGGGGGTGCAGATGC	752–770e	Matrix protein	Seasonal influenza A (H1N1) Influenza A (H3N2)
MF2-2	CGAATGGGAGTGCAGATGC	752–770e	Matrix protein	2009 influenza A (H1N1)
MR3-1b	TCCACAGCATTCTGCTGTTCC	947–967e	Matrix protein	Seasonal influenza A (H1N1) Influenza A (H3N2)
MR3-2b	TCCACAGCACTCTGCTGTTCC	947–967e	Matrix protein	2009 influenza A (H1N1)

^aF for forward primers and R for reverse primers.

^bAll the reverse primers with a Cy3- or biotin-labeled 5′-end.

^cNumber of the position of the primer according to GenBank accession number CY081570.

^dNumber of the position of the primer according to GenBank accession number CY091828.

^eNumber of the position of the primer according to GenBank accession number HQ011421.

^fNucleotides in italic showed the natural variants of different subtypes.

^gThe primers for neuraminidase were used for oseltamivir-resistant mutation fragment amplification and the primers of matrix protein were used for amantadine-resistant mutation fragment amplification.